View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8720_high_7 (Length: 261)
Name: NF8720_high_7
Description: NF8720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8720_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 90 - 260
Target Start/End: Complemental strand, 41885382 - 41885215
Alignment:
| Q |
90 |
agagatagagaaaatgaccttagggcttaggattatggtaaggaattcttcttctggtagagaaggaggaagaagaagaggtgatgtagttgatgccatg |
189 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41885382 |
agagagagagagaatgaccttagggcttaggattatggtaaggaattcttct---ggtagagaaggaggaggaagaagaggtgatgtagttgatgccatg |
41885286 |
T |
 |
| Q |
190 |
tcttgcagcaaatggcaacaacctctggtgtagaatgaagtgatgtagtttatactgtcgtgctttgttta |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41885285 |
tcttgcagcaaatggcaacaacctctggtgtagaatgaagtgatgtagtttatactgtcgtgctttgttta |
41885215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 41885533 - 41885432
Alignment:
| Q |
1 |
tttctcgaaatctttggaagtattgacatcg-tggtggtcatgtgaaaaagagggattgc-tgaagtggatgatgattgacgtagaaagttagagataga |
98 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41885533 |
tttctcgaaatctttgaaagtattgacatcggtggtggtcatgtgaaaaagagggattgcatgaagtggatgatgattgacgtagaaagttagagagaga |
41885434 |
T |
 |
| Q |
99 |
ga |
100 |
Q |
| |
|
|| |
|
|
| T |
41885433 |
ga |
41885432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University