View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8722_high_2 (Length: 263)
Name: NF8722_high_2
Description: NF8722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8722_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 2346809 - 2347037
Alignment:
| Q |
18 |
agagtagttgcttaccaagaaataaaactaaatgaatatttcctcgggttatttcttggcttctgaattatgtgtattgtttgttgtgatttcttcatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2346809 |
agagtagttgcttaccaagaaataaaactaaatgaacatttcctcgggttatttcttggcttctgaattatgtgtattgtttgttatgatttcttcatca |
2346908 |
T |
|
| Q |
118 |
acattcaatatctttcccagttactgttttcaatagagtcaatcgtcatgtagcacaatatcactaacagagggaattttatattggaaagaacattttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
2346909 |
acattcaatatctttcccagttactgttttcaatagagccaatcgtcaggtagcacaatatcactaacagagggaattttatgttggaatgaacattttt |
2347008 |
T |
|
| Q |
218 |
atacttttaaagagtcgaccacacatatt |
246 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
2347009 |
atacttttaaggagtcgaccacacatatt |
2347037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 2342875 - 2342923
Alignment:
| Q |
105 |
gatttcttcatcaacattcaatatctttcccagttactgttttcaatag |
153 |
Q |
| |
|
||||||||||||||||||||||| | ||| || |||||||||||||||| |
|
|
| T |
2342875 |
gatttcttcatcaacattcaataaccttcacaattactgttttcaatag |
2342923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University