View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8723_low_16 (Length: 239)
Name: NF8723_low_16
Description: NF8723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8723_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 5 - 223
Target Start/End: Original strand, 1923498 - 1923717
Alignment:
| Q |
5 |
aaaatttaactaagggaataatttgaaatgacaaatgtgcaaaaatannnnnnnncaggtcacattgaaagaatttca-agctacaaaattagaacattc |
103 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
1923498 |
aaaatttaactaagggtataattcaaaatgacaaatgtgcaaaaatattttttttcaggtcacattcaaagaatttcagagctacaaaattagaacattc |
1923597 |
T |
 |
| Q |
104 |
aatagactaatcaaacaagtgaaatttaccatataaagaaacaatgtcacaaagtacattaagaagagccattggagcagtaaaagatcaaacaagcata |
203 |
Q |
| |
|
||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1923598 |
aatagcctaatcaaacaagtcaaatttaccttataaagaaacaatgtcacaaagtacattaagaagagccattggagcagtgaaagatcaaacaagcata |
1923697 |
T |
 |
| Q |
204 |
ggcatagcaaaagttggaag |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1923698 |
ggcatagcaaaagttggaag |
1923717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University