View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8723_low_7 (Length: 345)
Name: NF8723_low_7
Description: NF8723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8723_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 16 - 319
Target Start/End: Complemental strand, 15236807 - 15236504
Alignment:
| Q |
16 |
tcgtgttaggcaatggcatttgcattagcaatttgatttccccttcttatagacacgtacttgtccaaccgattgaatttttggaattagccaccgtctt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
15236807 |
tcgtgttaggcaatggcatttgcattagcaatttgatttccccttcttatacacacgtacttgtccaacctattgactttttggaattagccactgtctt |
15236708 |
T |
|
| Q |
116 |
cagttggtgatcttcaattctccaacaattgttgatcgccgttaccaaggattttttcaagtagctttgcttgctacgtcatgtttgattggcaggtgga |
215 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| || ||| |
|
|
| T |
15236707 |
cagttggtggtcttcaattctccaacaattgttgatcgccgttaccaaggattttttcaagtagctttgcttgccacatcatgtttgattggcgggcgga |
15236608 |
T |
|
| Q |
216 |
gtttgcattaccggtccctccttcagcaaccgtgacaacaacgtctgcctatgttgttgcggccgtttcaccggtgccgagtgcaactgctgcggtccca |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15236607 |
gtttgcattaccggtccctccttcagcaaccgcgacaacaatgtctgcctctgttgttgcggccgtttctccggtgccgagtgcaactgctgcggtccca |
15236508 |
T |
|
| Q |
316 |
actc |
319 |
Q |
| |
|
|||| |
|
|
| T |
15236507 |
actc |
15236504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 180 - 317
Target Start/End: Original strand, 28014107 - 28014244
Alignment:
| Q |
180 |
ctttgcttgctacgtcatgtttgattggcaggtggagtttgcattaccggtccctccttcagcaaccgtgacaacaacgtctgcctatgttgttgcggcc |
279 |
Q |
| |
|
|||||||||| || ||||||||||||| ||| |||| | |||| |||||| ||||||| ||||| ||||||||||||||| | ||||||||| ||| |
|
|
| T |
28014107 |
ctttgcttgcctcgccatgtttgattggtaggcatggttttcgttactggtcccgccttcagtaaccgcgacaacaacgtctgcttctgttgttgcagcc |
28014206 |
T |
|
| Q |
280 |
gtttcaccggtgccgagtgcaactgctgcggtcccaac |
317 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28014207 |
gtttcaccggtgccgagtgcaactgttgcggtcccaac |
28014244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University