View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8724_low_11 (Length: 300)

Name: NF8724_low_11
Description: NF8724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8724_low_11
NF8724_low_11
[»] chr8 (2 HSPs)
chr8 (111-293)||(27227272-27227454)
chr8 (159-293)||(27223129-27223263)
[»] chr1 (8 HSPs)
chr1 (188-293)||(48655786-48655891)
chr1 (180-293)||(48666354-48666467)
chr1 (185-293)||(48652311-48652419)
chr1 (182-293)||(48628113-48628224)
chr1 (180-293)||(48584528-48584641)
chr1 (180-293)||(48660762-48660875)
chr1 (184-293)||(48619036-48619145)
chr1 (180-228)||(11546417-11546465)
[»] chr3 (1 HSPs)
chr3 (180-283)||(19666402-19666505)


Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 111 - 293
Target Start/End: Original strand, 27227272 - 27227454
Alignment:
111 gggcatgtatttcatacaccatggacaaggcacataatcaagacaacttattacatcttttgaatcgtgtcttaatgtcttccataaatgcatcaatatg 210  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27227272 gggcatgtatttcgtacaccatggacaaggcacataatcaagacaacttattacatcttttgaatcgtgtcttaatgtcttccataaatgcatcaatatg 27227371  T
211 ccgatcagaggaaccacctaccgcaactgcagcctccgctgccttcttccacttgattgtgttttgcttcaacatctctgctt 293  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27227372 ccgatcagaggaaccacctaccgcaactgcagcctccgctgccttcttccacttgattgtgttttgcttcaacatctctgctt 27227454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 159 - 293
Target Start/End: Original strand, 27223129 - 27223263
Alignment:
159 tattacatcttttgaatcgtgtcttaatgtcttccataaatgcatcaatatgccgatcagaggaaccacctaccgcaactgcagcctccgctgccttctt 258  Q
    ||||| ||||||||||||||| |||||||||||||||||||||||||| |||  |||||||||| |||||||  ||||| |||||||| |||||||||||    
27223129 tattatatcttttgaatcgtgccttaatgtcttccataaatgcatcaagatgttgatcagaggatccacctatggcaacagcagcctctgctgccttctt 27223228  T
259 ccacttgattgtgttttgcttcaacatctctgctt 293  Q
    ||||||||||| |||||||||||||  ||||||||    
27223229 ccacttgattgcgttttgcttcaactcctctgctt 27223263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 8)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 188 - 293
Target Start/End: Original strand, 48655786 - 48655891
Alignment:
188 tcttccataaatgcatcaatatgccgatcagaggaaccacctaccgcaactgcagcctccgctgccttcttccacttgattgtgttttgcttcaacatct 287  Q
    ||||| ||||||||||||| ||  || || ||||| |||||||| ||||||||| |||||||||||||||||||||||||||  |||| |||||||  ||    
48655786 tcttcgataaatgcatcaagatatcggtcggaggatccacctacggcaactgcatcctccgctgccttcttccacttgattgcatttttcttcaactcct 48655885  T
288 ctgctt 293  Q
    ||||||    
48655886 ctgctt 48655891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 180 - 293
Target Start/End: Original strand, 48666354 - 48666467
Alignment:
180 tcttaatgtcttccataaatgcatcaatatgccgatcagaggaaccacctaccgcaactgcagcctccgctgccttcttccacttgattgtgttttgctt 279  Q
    ||||||||||||||||||||||||||| ||| || || ||||||||||| ||||| |||||  ||||||| ||||| ||| ||||| |||  |||| |||    
48666354 tcttaatgtcttccataaatgcatcaagatgtcggtccgaggaaccaccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttctt 48666453  T
280 caacatctctgctt 293  Q
    |||| |||||||||    
48666454 caacgtctctgctt 48666467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 185 - 293
Target Start/End: Original strand, 48652311 - 48652419
Alignment:
185 atgtcttccataaatgcatcaatatgccgatcagaggaaccacctaccgcaactgcagcctccgctgccttcttccacttgattgtgttttgcttcaaca 284  Q
    ||||||| |||||||||||||| |||| ||||||| || |||||||  ||||| ||| |||||||||| ||||||||||||||||  |||| |||||||     
48652311 atgtcttgcataaatgcatcaagatgcagatcagatgatccacctatggcaaccgcatcctccgctgctttcttccacttgattgcatttttcttcaact 48652410  T
285 tctctgctt 293  Q
     ||||||||    
48652411 cctctgctt 48652419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 182 - 293
Target Start/End: Original strand, 48628113 - 48628224
Alignment:
182 ttaatgtcttccataaatgcatcaatatgccgatcagaggaaccacctaccgcaactgcagcctccgctgccttcttccacttgattgtgttttgcttca 281  Q
    ||||||||||||||||||||||||| || || ||||||||| ||||| || || |||||  |||| ||  ||||||||||||| ||||  |||| |||||    
48628113 ttaatgtcttccataaatgcatcaagattccaatcagaggatccaccaacggccactgcttcctctgcctccttcttccacttcattgcatttttcttca 48628212  T
282 acatctctgctt 293  Q
    ||  ||||||||    
48628213 actcctctgctt 48628224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 180 - 293
Target Start/End: Original strand, 48584528 - 48584641
Alignment:
180 tcttaatgtcttccataaatgcatcaatatgccgatcagaggaaccacctaccgcaactgcagcctccgctgccttcttccacttgattgtgttttgctt 279  Q
    |||||||||||||||||||  |||||| || |||||||||||| ||||| || || |  ||  |||||||   ||||||||||||| |||  ||||||||    
48584528 tcttaatgtcttccataaactcatcaagattccgatcagaggatccaccaacggccaaagcttcctccgccttcttcttccacttgtttgcattttgctt 48584627  T
280 caacatctctgctt 293  Q
    |||| |||||||||    
48584628 caacttctctgctt 48584641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 180 - 293
Target Start/End: Original strand, 48660762 - 48660875
Alignment:
180 tcttaatgtcttccataaatgcatcaatatgccgatcagaggaaccacctaccgcaactgcagcctccgctgccttcttccacttgattgtgttttgctt 279  Q
    ||||||||||||  ||||||||||||| ||| || || ||||||||||| || || |  ||| |||| |||||| |||||||||| ||||  ||||| ||    
48660762 tcttaatgtcttggataaatgcatcaagatgtcggtccgaggaaccaccgactgccatcgcatcctctgctgccgtcttccacttcattgcattttgttt 48660861  T
280 caacatctctgctt 293  Q
    |||| |||||||||    
48660862 caacctctctgctt 48660875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 293
Target Start/End: Complemental strand, 48619145 - 48619036
Alignment:
184 aatgtcttccataaatgcatcaatatgccgatcagaggaaccacctaccgcaactgcagcctccgctgccttcttccacttgattgtgttttgcttcaac 283  Q
    |||||||||||||||| |||||| || |||||||||||| ||||| |  || |||||  | |||||   |||||||||||| ||||  |||| |||||||    
48619145 aatgtcttccataaattcatcaagattccgatcagaggatccaccaatggccactgcttcatccgccttcttcttccacttcattgcatttttcttcaac 48619046  T
284 atctctgctt 293  Q
      ||||||||    
48619045 tcctctgctt 48619036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 228
Target Start/End: Original strand, 11546417 - 11546465
Alignment:
180 tcttaatgtcttccataaatgcatcaatatgccgatcagaggaaccacc 228  Q
    ||||||||||||||| |||| |||||| || |||||||||||| |||||    
11546417 tcttaatgtcttccaaaaattcatcaagattccgatcagaggatccacc 11546465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 180 - 283
Target Start/End: Complemental strand, 19666505 - 19666402
Alignment:
180 tcttaatgtcttccataaatgcatcaatatgccgatcagaggaaccacctaccgcaactgcagcctccgctgccttcttccacttgattgtgttttgctt 279  Q
    |||||||||||||||||||| |||||| || ||||||||||||||||||   ||| || ||  ||||||| || ||||||||||||||||  ||||||||    
19666505 tcttaatgtcttccataaattcatcaagattccgatcagaggaaccaccggtcgccaccgcttcctccgccgctttcttccacttgattgcattttgctt 19666406  T
280 caac 283  Q
    ||||    
19666405 caac 19666402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University