View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8724_low_13 (Length: 242)
Name: NF8724_low_13
Description: NF8724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8724_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 35059937 - 35059704
Alignment:
| Q |
1 |
cggtagaggtggagggtgataggaagagtgacatgtgcacccattgatatgagtcgcttggcaaattgaagggctgggtttatgtggccttgagctgggt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35059937 |
cggtagaggtggagggtgatgggaagagtgacatgtgcacccattgatatgagtcgcttggcaaattgaagggctgggtttatgtggccttgagctgggt |
35059838 |
T |
|
| Q |
101 |
acgttaccagaaggatgcggtggtg---gtgggacatgattgcaatggggagggagattggtatcactacttgtcacgcatgtatgcacg----tttatt |
193 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
35059837 |
acgttaccagaaggatgcggtggtggtggtgggacatgattgcaatg----gggagattggtatcacgacttgtcacgcatgtatgcacgtttatttatt |
35059742 |
T |
|
| Q |
194 |
tatattaatggactcactcaaccattgtttattttgat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35059741 |
tatattaatggactcactcaaccattgtttattttgat |
35059704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University