View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8725_high_1 (Length: 513)
Name: NF8725_high_1
Description: NF8725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8725_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 461; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 461; E-Value: 0
Query Start/End: Original strand, 1 - 501
Target Start/End: Complemental strand, 52543331 - 52542831
Alignment:
| Q |
1 |
caagccattcatgcccgttctgttttcccttgtcaggacacaccagccattagggtttgttattctgcccggttgaatattcccaaagaattgacggctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52543331 |
caagccattcatgcccgttctgttttcccttgtcaggacacaccagccattagggtttgttattcggcccggttgaatattcccaaagaattgacggctg |
52543232 |
T |
 |
| Q |
101 |
tcatggctgcaaaacatgtggcgcgccgcgaatcattggttgacgacgagtgttttgggaattcttggcaaggtagagtggtggaagagtttgagatgga |
200 |
Q |
| |
|
| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
52543231 |
ttatggctgcaaaacatgtggcgctccgcgaatcattggttgacgacgagtgttttgggaattcgtccaaaggtagagtggtggaagagtttgagatgga |
52543132 |
T |
 |
| Q |
201 |
acttccaattccaccttacctttttgcatttgcagttggggagcttgataacagggaggtggggcccaggactagggtttatgctgaatctgtgactcaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52543131 |
acttccaattccaccttacctttttgcatttgcagttggggagcttgataacagggaggtggggcccaggactagggtttatgctgaagctgtgactcaa |
52543032 |
T |
 |
| Q |
301 |
ctgttggattcagctgctaaagagtttgatggaactgaggatatgattagggaaggggaaagattgtttggaaattatgagtgggagagatttgatttgt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52543031 |
ctgttggattcagctgctaaagagtttgatggaactgaggatatgattagggaaggggaaagattgtttggaaattatgagtgggagagatttgatttgt |
52542932 |
T |
 |
| Q |
401 |
tggttttgccacctagttttccttatggtggtatggagaatcctaggatggtgttcttgaccccgacggttattaaaggggatgcaactggtgcacaggt |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
52542931 |
tggttttgccacctagttttccttatggtggtatggagaatcctaggatggtgttcttgaccccaacagttattaaaggggatgcaactggtgcacaggt |
52542832 |
T |
 |
| Q |
501 |
t |
501 |
Q |
| |
|
| |
|
|
| T |
52542831 |
t |
52542831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University