View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8725_high_6 (Length: 247)
Name: NF8725_high_6
Description: NF8725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8725_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 9 - 228
Target Start/End: Complemental strand, 56313751 - 56313529
Alignment:
| Q |
9 |
atattgtactaggtgcctaggttgatgctgctgctgc---atcatcatcaatccttcttcctcttctgaacggtaattagtaggaggaggagtattgcta |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313751 |
atattgtactaggtgcctaggttgatgctgctgctgctgcataatcatcaatccttcttcttcttctgaacggtaattagtaggaggaggagtattgcta |
56313652 |
T |
|
| Q |
106 |
tacttggaaagcccaagagttgttgtgacatgatctgaattaccgccgctactgcttccttccattttgttaactatgtgatcatcaattgtctttggtg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313651 |
tacttggaaagcccaagagttgttgtgacatgatctgaattaccgccgctactgcttccttccattttgttaactatgtgatcatcaattgtctttggtg |
56313552 |
T |
|
| Q |
206 |
attgtccaacaacaaatcccatt |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
56313551 |
attgtccaacaacaaatcccatt |
56313529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University