View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8725_low_8 (Length: 241)
Name: NF8725_low_8
Description: NF8725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8725_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 237
Target Start/End: Original strand, 51771074 - 51771295
Alignment:
| Q |
20 |
cagtcgataatgatgttattgctgctaattgcttctctcactcac----tctccctttcttgatgttactacttgagagagaaagagtgttgttttctaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51771074 |
cagtcgataatgatgttattgctgctaattgcttctctcactcacacactctccctttcttgatgttactacttgagagagaaagagtgttgttttctaa |
51771173 |
T |
|
| Q |
116 |
aatgggaaaatcgattggttagggtatagagacagtaatagtatttgcaggcattgagcaagttttggggaaggccggtgaaaggccattttcaactttc |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51771174 |
aatgggaaaatggattggttagggtatagagacagtaatagtatttgcaggcattgagcaagttttggggaaggccggtgaaaggccattttcaactttc |
51771273 |
T |
|
| Q |
216 |
tctctgttccttcttctcactc |
237 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
51771274 |
tctctgttccttctactcactc |
51771295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University