View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8727_high_12 (Length: 255)
Name: NF8727_high_12
Description: NF8727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8727_high_12 |
 |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold1160 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 43 - 110
Target Start/End: Original strand, 2443793 - 2443860
Alignment:
| Q |
43 |
agccgggctcctccagattgactcaaacacccacttctccaagttattcaacctatcatcatctataa |
110 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2443793 |
agccgggctcctccaaattgactcaaacatccacttctccaagttattcaacctatcatcatctataa |
2443860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 43 - 102
Target Start/End: Complemental strand, 7425078 - 7425019
Alignment:
| Q |
43 |
agccgggctcctccagattgactcaaacacccacttctccaagttattcaacctatcatc |
102 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7425078 |
agccgggctcttccaaattgactcaaacacccacttctccaagttattcaatctatcatc |
7425019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 43 - 102
Target Start/End: Original strand, 12220592 - 12220651
Alignment:
| Q |
43 |
agccgggctcctccagattgactcaaacacccacttctccaagttattcaacctatcatc |
102 |
Q |
| |
|
|||||| ||| |||| ||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
12220592 |
agccggactcttccaaattgactcaaaaacccacttctccaagttattcaatctatcatc |
12220651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 178 - 224
Target Start/End: Original strand, 2339179 - 2339225
Alignment:
| Q |
178 |
atggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2339179 |
atggggtggcggtggctcccccttgccaccccccagttccgccactg |
2339225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 175 - 224
Target Start/End: Complemental strand, 52893190 - 52893141
Alignment:
| Q |
175 |
aggatggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
52893190 |
aggatggggtggcggtggctcccccttgccaacccccagttccgccactg |
52893141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 181 - 223
Target Start/End: Complemental strand, 9456161 - 9456119
Alignment:
| Q |
181 |
gggtggtggtggctcccccttgccaccccccagttctgccact |
223 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9456161 |
gggtggcggtggctcccccttgccaccccccagttccgccact |
9456119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 165 - 210
Target Start/End: Complemental strand, 40922607 - 40922562
Alignment:
| Q |
165 |
tttcacacaaaggatggggtggtggtggctcccccttgccaccccc |
210 |
Q |
| |
|
||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
40922607 |
tttcacataaaaaatggggtggcggtggctcccccttgccaccccc |
40922562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 21453176 - 21453228
Alignment:
| Q |
173 |
aaaggatggggtggtggtggctcccccttgccaccccccagttctgccactga |
225 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21453176 |
aaaggatggggtggcggtggctcccccttgccaccccccagttccgccactga |
21453228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 132 - 224
Target Start/End: Original strand, 12003285 - 12003377
Alignment:
| Q |
132 |
aaataataattttaatgaaaggtataatggtattttcacacaaaggatggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
||||| || |||||||||| || ||||| ||| |||| |||||||||||||| ||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
12003285 |
aaatattagttttaatgaagggcataatagtaatttccataaaaggatggggtggcggtggctcctccttgccaccccccagttccgccactg |
12003377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 31419012 - 31418966
Alignment:
| Q |
178 |
atggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
31419012 |
atggggtggcggtggctcccccttgccaccccccggttccgccactg |
31418966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 224
Target Start/End: Original strand, 6472699 - 6472735
Alignment:
| Q |
188 |
ggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6472699 |
ggtggctcccccttgccaccccccagttccgccactg |
6472735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 175 - 224
Target Start/End: Original strand, 21745030 - 21745079
Alignment:
| Q |
175 |
aggatggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21745030 |
aggatggggtggcggtggctcccccttgccaccccccagttccgccactg |
21745079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 175 - 224
Target Start/End: Original strand, 42740885 - 42740934
Alignment:
| Q |
175 |
aggatggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42740885 |
aggatggggtggcggtggctcccccttgccaccccccagttccgccactg |
42740934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 177 - 225
Target Start/End: Complemental strand, 32863380 - 32863332
Alignment:
| Q |
177 |
gatggggtggtggtggctcccccttgccaccccccagttctgccactga |
225 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32863380 |
gatggggtggcggtggctcccccttgccaccccccagttccgccactga |
32863332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 177 - 224
Target Start/End: Complemental strand, 3173896 - 3173850
Alignment:
| Q |
177 |
gatggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
3173896 |
gatggggtggcggtggctcccccttgccac-ccccagttccgccactg |
3173850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 180 - 231
Target Start/End: Complemental strand, 43299980 - 43299930
Alignment:
| Q |
180 |
ggggtggtggtggctcccccttgccaccccccagttctgccactgactataa |
231 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
43299980 |
ggggtggcggtggctcccccttgcca-accccagttccgccactgactataa |
43299930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 225
Target Start/End: Original strand, 18740033 - 18740082
Alignment:
| Q |
175 |
aggatggggtggtggtggctcccccttgccaccccccagttctgccactga |
225 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
18740033 |
aggatggggtggcggtggctcccccttgcca-accccagttccgccactga |
18740082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 26063087 - 26063041
Alignment:
| Q |
178 |
atggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| | || ||||||| |
|
|
| T |
26063087 |
atggggtggcggtggctcccccttgccaccccccggctccgccactg |
26063041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 178 - 222
Target Start/End: Original strand, 33754314 - 33754358
Alignment:
| Q |
178 |
atggggtggtggtggctcccccttgccaccccccagttctgccac |
222 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33754314 |
atggggtggcggtggctcccccttgccaccccccagttctgccac |
33754358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 225
Target Start/End: Original strand, 46164750 - 46164798
Alignment:
| Q |
177 |
gatggggtggtggtggctcccccttgccaccccccagttctgccactga |
225 |
Q |
| |
|
||||| |||| |||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
46164750 |
gatggagtggcggtggctcccccttgccaccacccagttccgccactga |
46164798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 224
Target Start/End: Original strand, 14800345 - 14800404
Alignment:
| Q |
165 |
tttcacacaaaggatggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
||||||| ||| ||||||||| |||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
14800345 |
tttcacataaataatggggtggctgtggctcccccttgccaccccctagttccgccactg |
14800404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 177 - 210
Target Start/End: Original strand, 8433370 - 8433403
Alignment:
| Q |
177 |
gatggggtggtggtggctcccccttgccaccccc |
210 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
8433370 |
gatggggtggcggtggctcccccttgccaccccc |
8433403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 175 - 216
Target Start/End: Complemental strand, 44504382 - 44504341
Alignment:
| Q |
175 |
aggatggggtggtggtggctcccccttgccaccccccagttc |
216 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||| ||||| |
|
|
| T |
44504382 |
aggatggggtggcggtggctcccccttgccaacccctagttc |
44504341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 210
Target Start/End: Complemental strand, 21421965 - 21421933
Alignment:
| Q |
178 |
atggggtggtggtggctcccccttgccaccccc |
210 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
21421965 |
atggggtggcggtggctcccccttgccaccccc |
21421933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 209
Target Start/End: Complemental strand, 47825637 - 47825605
Alignment:
| Q |
177 |
gatggggtggtggtggctcccccttgccacccc |
209 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
47825637 |
gatggggtggcggtggctcccccttgccacccc |
47825605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 1667869 - 1667823
Alignment:
| Q |
178 |
atggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1667869 |
atggggtggcggtggctcccccttgccaccccccagttccgccactg |
1667823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 16658574 - 16658528
Alignment:
| Q |
178 |
atggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
16658574 |
atggggtggcggtgtctcccccttgccaccccccagttccgccactg |
16658528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 224
Target Start/End: Complemental strand, 33360160 - 33360101
Alignment:
| Q |
165 |
tttcacacaaaggatggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
||||||| ||| ||||||||| ||||||||||||||||||||||| | ||| ||||||| |
|
|
| T |
33360160 |
tttcacagaaataatggggtggcggtggctcccccttgccaccccctaattccgccactg |
33360101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 177 - 210
Target Start/End: Complemental strand, 32381244 - 32381211
Alignment:
| Q |
177 |
gatggggtggtggtggctcccccttgccaccccc |
210 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
32381244 |
gatggggtggcggtggctcccccttgccaccccc |
32381211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 177 - 210
Target Start/End: Complemental strand, 32435199 - 32435166
Alignment:
| Q |
177 |
gatggggtggtggtggctcccccttgccaccccc |
210 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
32435199 |
gatggggtggcggtggctcccccttgccaccccc |
32435166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 224
Target Start/End: Original strand, 16497559 - 16497606
Alignment:
| Q |
177 |
gatggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
16497559 |
gatggggtggcggtggctcccccttgccaccccgcagttccgccactg |
16497606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 165 - 210
Target Start/End: Complemental strand, 7170775 - 7170730
Alignment:
| Q |
165 |
tttcacacaaaggatggggtggtggtggctcccccttgccaccccc |
210 |
Q |
| |
|
||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
7170775 |
tttcacataaataatggggtggcggtggctcccccttgccaccccc |
7170730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 225
Target Start/End: Original strand, 14125097 - 14125144
Alignment:
| Q |
177 |
gatggggtggtggtggctcccccttgccaccccccagttctgccactga |
225 |
Q |
| |
|
|||||||| | |||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
14125097 |
gatggggtagcggtggctcccccttgcca-cccccagttccgccactga |
14125144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 182 - 216
Target Start/End: Original strand, 38978988 - 38979022
Alignment:
| Q |
182 |
ggtggtggtggctcccccttgccaccccccagttc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38978988 |
ggtggtggtggctcccccttgccaccccccagttc |
38979022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 26014262 - 26014217
Alignment:
| Q |
177 |
gatggggtggtggtggctcccccttgccaccccccagttctgccac |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
26014262 |
gatggggtggcggtggctcccccttgccaccccccaattccgccac |
26014217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 210
Target Start/End: Original strand, 18994627 - 18994659
Alignment:
| Q |
178 |
atggggtggtggtggctcccccttgccaccccc |
210 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
18994627 |
atggggtggcggtggctcccccttgccaccccc |
18994659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 224
Target Start/End: Complemental strand, 39382 - 39323
Alignment:
| Q |
165 |
tttcacacaaaggatggggtggtggtggctcccccttgccaccccccagttctgccactg |
224 |
Q |
| |
|
||||||| ||| ||||||||| |||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
39382 |
tttcacataaataatggggtggctgtggctcccccttgccaccccctagttccgccactg |
39323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1160 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1160
Description:
Target: scaffold1160; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 2214 - 2168
Alignment:
| Q |
175 |
aggatggggtggtggtggctcccccttgccaccccccagttctgcca |
221 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| ||||| |||| |
|
|
| T |
2214 |
aggatggggtggcggtggctcccccttaccaccccctagttccgcca |
2168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University