View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8727_high_14 (Length: 242)
Name: NF8727_high_14
Description: NF8727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8727_high_14 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 153 - 242
Target Start/End: Original strand, 5969330 - 5969419
Alignment:
| Q |
153 |
gggacccgcgacccttgggcttgtgtttgttgaagctgttgctgggccgcccgacgacatcgcgaacgacggtatggtaaatttacgaac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5969330 |
gggacccgcgacccttgggcttgtgtttgttgaagctgttgctgggccgcccgacgacatcgcgaacgacggtatggtaaatttacgaac |
5969419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 18 - 86
Target Start/End: Original strand, 5969195 - 5969263
Alignment:
| Q |
18 |
gtttaaatttaataatgatgaaacaggatcattgtcttgatgttctagttcggagaaatctgggaaact |
86 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5969195 |
gtttaaatttaataacgatgaaacaggatcattgtcttgatgttctagttcggagaaatctgggaaact |
5969263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University