View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8727_high_21 (Length: 205)
Name: NF8727_high_21
Description: NF8727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8727_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 3 - 197
Target Start/End: Complemental strand, 5522263 - 5522069
Alignment:
| Q |
3 |
ccagctcctacacgtaatgtctttggttaccaagttgagctacacttacatgacatggaatataatttaatgcttattaaaaaggagaaatgccaagtgc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5522263 |
ccagctcctacacgtaatgtctttggttaccaagttgagctacacttacatgacatggaatataatttaatgcttattaaaaaggagaaatgccaagtgc |
5522164 |
T |
 |
| Q |
103 |
actttagaaatcttacaagtcttttgtttattataaagataaagatgaattttttaaaaggtttttgagaggtgttgttatttaatttagtatta |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5522163 |
actttagaaatcttacaagtcttttgtttattataaagataaagatggattttttttaaggtttttgagaggtgttgttatttaatttagtatta |
5522069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University