View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8727_low_15 (Length: 253)
Name: NF8727_low_15
Description: NF8727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8727_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 2 - 194
Target Start/End: Complemental strand, 12000929 - 12000735
Alignment:
| Q |
2 |
gggatgatgttcattggtggcataggatggtaacaatctgggaatttgtgtggatgttgacannnnnnnnn-cttatatgaaaacaagaaggttagtgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12000929 |
gggatgatgttcattggtggcataggatggtaacaatctgggaatt-gtgtggatgttgacattttttttttcttatatgaaaacaagaaggttagtgag |
12000831 |
T |
|
| Q |
101 |
gcaaggggagttggttgaatagaaagatgagtgcaagagaaggaaa--atgaccacaattttttagatgggaatgagagaatataagttcaatcta |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12000830 |
gcaaggggagttggttgaatagaaagatgagtgcaagagaaggaaaatatgaccacaattttctagatgggaatgagagaatataagttcaatcta |
12000735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 147
Target Start/End: Complemental strand, 17646964 - 17646924
Alignment:
| Q |
107 |
ggagttggttgaatagaaagatgagtgcaagagaaggaaaa |
147 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
17646964 |
ggagttggttgaatggaaagatgagtagaagagaaggaaaa |
17646924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University