View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8727_low_16 (Length: 242)

Name: NF8727_low_16
Description: NF8727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8727_low_16
NF8727_low_16
[»] chr4 (2 HSPs)
chr4 (153-242)||(5969330-5969419)
chr4 (18-86)||(5969195-5969263)


Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 153 - 242
Target Start/End: Original strand, 5969330 - 5969419
Alignment:
153 gggacccgcgacccttgggcttgtgtttgttgaagctgttgctgggccgcccgacgacatcgcgaacgacggtatggtaaatttacgaac 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5969330 gggacccgcgacccttgggcttgtgtttgttgaagctgttgctgggccgcccgacgacatcgcgaacgacggtatggtaaatttacgaac 5969419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 18 - 86
Target Start/End: Original strand, 5969195 - 5969263
Alignment:
18 gtttaaatttaataatgatgaaacaggatcattgtcttgatgttctagttcggagaaatctgggaaact 86  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
5969195 gtttaaatttaataacgatgaaacaggatcattgtcttgatgttctagttcggagaaatctgggaaact 5969263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University