View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8729_low_9 (Length: 269)
Name: NF8729_low_9
Description: NF8729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8729_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 159 - 227
Target Start/End: Complemental strand, 11135820 - 11135753
Alignment:
| Q |
159 |
aaccataccagaaaaacaaaatcaaacaacannnnnnnaaaataatcagttttagaaaattcaatctgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11135820 |
aaccataccagaaaaacaaaatcaaacaacatttttt-aaaataatcagttttagaaaattcaatctgt |
11135753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 53
Target Start/End: Complemental strand, 11135962 - 11135926
Alignment:
| Q |
17 |
aaatcttcaccattaagtatctcaaccatactgtact |
53 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11135962 |
aaatcttcaccattaagtatctcaacaatactgtact |
11135926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 256
Target Start/End: Complemental strand, 11135299 - 11135267
Alignment:
| Q |
224 |
ctgtcagacacatatgcaatcgtgtccgtgtgt |
256 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
11135299 |
ctgtcagacacatatgcaatcgtgtcagtgtgt |
11135267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University