View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8729_low_9 (Length: 269)

Name: NF8729_low_9
Description: NF8729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8729_low_9
NF8729_low_9
[»] chr4 (3 HSPs)
chr4 (159-227)||(11135753-11135820)
chr4 (17-53)||(11135926-11135962)
chr4 (224-256)||(11135267-11135299)


Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 159 - 227
Target Start/End: Complemental strand, 11135820 - 11135753
Alignment:
159 aaccataccagaaaaacaaaatcaaacaacannnnnnnaaaataatcagttttagaaaattcaatctgt 227  Q
    |||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||    
11135820 aaccataccagaaaaacaaaatcaaacaacatttttt-aaaataatcagttttagaaaattcaatctgt 11135753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 53
Target Start/End: Complemental strand, 11135962 - 11135926
Alignment:
17 aaatcttcaccattaagtatctcaaccatactgtact 53  Q
    |||||||||||||||||||||||||| ||||||||||    
11135962 aaatcttcaccattaagtatctcaacaatactgtact 11135926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 256
Target Start/End: Complemental strand, 11135299 - 11135267
Alignment:
224 ctgtcagacacatatgcaatcgtgtccgtgtgt 256  Q
    |||||||||||||||||||||||||| ||||||    
11135299 ctgtcagacacatatgcaatcgtgtcagtgtgt 11135267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University