View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8730_low_13 (Length: 253)
Name: NF8730_low_13
Description: NF8730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8730_low_13 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 4 - 253
Target Start/End: Original strand, 24276933 - 24277182
Alignment:
| Q |
4 |
ggagaagcagagagatttccagggagcaaccggttcaagaggcacatcatgtgggacaggtgttttcttgccacgtggtggagtcggtgcttttcagtca |
103 |
Q |
| |
|
|||||||| || |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24276933 |
ggagaagcggacagattttcagggagcaaccggttcaagaggcacatcatgtgggacaggtgttttcttgccacgtggtggagtcagtgcttttcagtca |
24277032 |
T |
|
| Q |
104 |
catcagactaagagacctggtatgcaacaaactaactatgtgatcttccccgtttaccaactttaatgtgtttacttttaatactgtgagtatggtttta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
24277033 |
catcagactaagagacctggtatgcaacaaactaactatgtgatcttccccgtttaccgactttaatgtgtttacttttaatattgtaagtatggtttta |
24277132 |
T |
|
| Q |
204 |
aattgtggtccgcaatcgttaaatgacattattgctgcaatttaaaccac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24277133 |
aattgtggtccgcaatcgttaaatgacattattgctgcaatttaaaccac |
24277182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University