View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8730_low_20 (Length: 227)
Name: NF8730_low_20
Description: NF8730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8730_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 46128889 - 46129109
Alignment:
| Q |
1 |
gattactagtttttccctaagttaatgttttatgaaataggcctcaaaa-taagaaaattattatgagaaatccaactttatgttgctaaacttttttgc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46128889 |
gattactagtttttccctaagttaatgttttatgaaataggcctcaaaaataagaaaattattatgagaaatccaactttatgttgctaaacttttttgc |
46128988 |
T |
 |
| Q |
100 |
tatgagaattcaaccttagtttgtgtaggaatcatgaacactgatttacctttaccttagcttacttcaactcagcattccttattaaagagagccccca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46128989 |
tatgagaattcaaccttagtttgtgtaggaatcatgaacactgatttacctttaccttagcttacttcaactcagcattccttattaaagagagccccca |
46129088 |
T |
 |
| Q |
200 |
tgatagagcatattcatctca |
220 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
46129089 |
tggtagagcatattcatctca |
46129109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University