View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8730_low_21 (Length: 221)
Name: NF8730_low_21
Description: NF8730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8730_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 3 - 202
Target Start/End: Complemental strand, 36628329 - 36628129
Alignment:
| Q |
3 |
caaaaacaaattcaaaaattgatttggtcataccgataacaaagcaaatgtatctctttcctaaaataatacactttggtcaactgtgtgannnnnnnnn |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36628329 |
caaaaacaaattcaaaaattgatttggtgataccgataacaaagcaaatgtatctttttcctaaaataatacactttggtcaactgtgtgattttttttt |
36628230 |
T |
 |
| Q |
103 |
n-accaaaacatacgttagttcatgcttcatactagtcttaatcttataatttatgcactatataaccacttgtggtaatgttaaggcagtacattcaat |
201 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36628229 |
ttaccaaaagatacgtttgttcatgcttcatactagtcttaatcttataatttatgcactatataaccacttgtggtattgttaaggcagtacattcaat |
36628130 |
T |
 |
| Q |
202 |
c |
202 |
Q |
| |
|
| |
|
|
| T |
36628129 |
c |
36628129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University