View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8731_high_6 (Length: 247)
Name: NF8731_high_6
Description: NF8731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8731_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 240
Target Start/End: Original strand, 32824833 - 32825067
Alignment:
| Q |
6 |
atatccaacatctctaactccctcaatttctctttcaccatacaatattttctttctttcatatccttagaagtaaatgatgaatctttttgctttcctc |
105 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32824833 |
atatccaacatctccaactccttcaatttctctttcaccatacaatattttctttctttcatatccttagaagtaaatgatgaatctttttgctttcctc |
32824932 |
T |
 |
| Q |
106 |
tttgaatggtcaatttcttctcattgtttttgttgtcgaaaacctctcttttattcgcccgatttttctcctcagaagggcttgcattagacaatttcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32824933 |
tttgaatggtcaatttcttctcattgtttttgttgtcgaaaacctctcttttattcgcccaatttttcttctcagaagggcttgcattagacaatttcat |
32825032 |
T |
 |
| Q |
206 |
atagctaccattagtgttgttaatgttgatgtcca |
240 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||| |
|
|
| T |
32825033 |
atagctaccactagtgttgttaatgttcatgtcca |
32825067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University