View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8731_low_1 (Length: 465)
Name: NF8731_low_1
Description: NF8731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8731_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 433; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 433; E-Value: 0
Query Start/End: Original strand, 12 - 448
Target Start/End: Complemental strand, 30138554 - 30138118
Alignment:
| Q |
12 |
atggacatcaattgcatgggcttcaggtttaaccttagccattccaatcctcactttcatctctttccaccttaacagccaataccaaaccctaatcaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138554 |
atggacatcaattgcatgggcttcaggtttaaccttagccattccaatcctcactttcatctctttccaccttaacagccaataccaaaccctaatcaca |
30138455 |
T |
 |
| Q |
112 |
gcagcatccacaggcattggagttttcttctgtcttccagcaggattcttcaaaacaaccttaatcttcattccctacattgctttcatagtcttagcta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138454 |
gcagcatccacaggcattggagttttcttctgtcttccagcaggattcttcaaaacaaccttaatcttcattccctacattgctttcatagtcttagcta |
30138355 |
T |
 |
| Q |
212 |
gcacagttgcaagttcatctcacactcaccatcttgctctcatgatttcttccttcaacaaatccaaaacaaacaaagtttcaagtttcttctctcttta |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138354 |
gcacagttgcaagttcatctcacactcaccatcttgctctcatgatttcttccttcaacaaatccaaaacaaacaaagtttcaagtttcttctctcttta |
30138255 |
T |
 |
| Q |
312 |
tgctacttcttttggttgtttaggttcagccattatctcttctttcatttaccatatgcttcgagaacccgatgatcgtaattatttcaccctttggatt |
411 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30138254 |
tgctacttcttttggttgtttaggttcagccattatctcttctttcatttaccatatgcttcgagaacctgatgatcgtaattatttcaccctttggatt |
30138155 |
T |
 |
| Q |
412 |
gtttcaatcttcagtggcttaatttggttagttggtg |
448 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138154 |
gtttcaatcttcagtggcttaatttggttagttggtg |
30138118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University