View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8731_low_10 (Length: 215)
Name: NF8731_low_10
Description: NF8731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8731_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 133 - 179
Target Start/End: Original strand, 41251543 - 41251589
Alignment:
| Q |
133 |
ttattattgagtcatatatgaccgcccacgcttttgtgagttgtaat |
179 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41251543 |
ttattattgggtcatatatgaccgcccacgcttttgtgagttgtaat |
41251589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 41251434 - 41251471
Alignment:
| Q |
20 |
atatgggcctcatggtttctcacgtaagaataatgtga |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41251434 |
atatgggcctcatggtttctcacgtaagaataatgtga |
41251471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University