View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8731_low_10 (Length: 215)

Name: NF8731_low_10
Description: NF8731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8731_low_10
NF8731_low_10
[»] chr5 (2 HSPs)
chr5 (133-179)||(41251543-41251589)
chr5 (20-57)||(41251434-41251471)


Alignment Details
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 133 - 179
Target Start/End: Original strand, 41251543 - 41251589
Alignment:
133 ttattattgagtcatatatgaccgcccacgcttttgtgagttgtaat 179  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||    
41251543 ttattattgggtcatatatgaccgcccacgcttttgtgagttgtaat 41251589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 41251434 - 41251471
Alignment:
20 atatgggcctcatggtttctcacgtaagaataatgtga 57  Q
    ||||||||||||||||||||||||||||||||||||||    
41251434 atatgggcctcatggtttctcacgtaagaataatgtga 41251471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University