View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8731_low_4 (Length: 365)
Name: NF8731_low_4
Description: NF8731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8731_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 116 - 349
Target Start/End: Complemental strand, 4175884 - 4175651
Alignment:
| Q |
116 |
tcatcaacaacatcactaattcgttccaattcaatttcactctcttccaacaaatccatcaacgacatgctaacctgtgccgtctcatcggaaaactcgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4175884 |
tcatcaacaacatcactaattcgttccaattcaatttcactctcttccaacaaatccatcaacgacatgctaacctgtgccgtctcatcggaaaactcgc |
4175785 |
T |
 |
| Q |
216 |
cgccgggaagaaattccgacggatctgaattggtcggaatatcttcgttttgttgttgttggtgagttgattcacccgaggtacgacgtttgaaaagaag |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4175784 |
cgccgggaagaaattccgacggatctgaattggtcggaatatcttcgttttgttgttgttggtgagttgattcatccgaggtacgacgtttgaaaagaag |
4175685 |
T |
 |
| Q |
316 |
taattccttaagagctttccatgattttcgatct |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
4175684 |
taattccttaaaagctttccatgattttcgatct |
4175651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 16 - 53
Target Start/End: Complemental strand, 4175996 - 4175959
Alignment:
| Q |
16 |
acacacgcaacaattgtgttccaccttaacattactcc |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4175996 |
acacacgcaacaattgtgttccaccttaacattactcc |
4175959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University