View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8731_low_7 (Length: 250)
Name: NF8731_low_7
Description: NF8731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8731_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 236
Target Start/End: Original strand, 45308207 - 45308429
Alignment:
| Q |
10 |
atgatatttaggttgatcatcagttgtctaatgtagagtatcgtcgttgcactagatcacaggggtagaagctcgatgaattaattaggatattgcttgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45308207 |
atgatatttaggttgatcatcagttgtctaatgtagagtatcgtcgttgcactagatcacaggggtagaagctcgatgaatt----aggatattgcttgg |
45308302 |
T |
|
| Q |
110 |
aatcctcctgagaccaattctgaatttgctacaattttcttaaatgtgattgaggcaatgcagtataattaaagaatgattagctattaattaattatta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45308303 |
aatcctcctgagaccaattctgaatttgctacaattttcttaaatgtgattgaggcaatgcagtataattaaagaatgattagctattaattaattatta |
45308402 |
T |
|
| Q |
210 |
ttttatttgaggatcaatgtggcagtt |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
45308403 |
ttttatttgaggatcaatgtggcagtt |
45308429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University