View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8732_low_2 (Length: 252)
Name: NF8732_low_2
Description: NF8732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8732_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 96 - 216
Target Start/End: Original strand, 34450828 - 34450949
Alignment:
| Q |
96 |
gtgttgatggattcttcaaattatgtgcactctaaagttattttttcttcaatggggtgaaatatcaaacaattataaggtacattaccaataa-ttttt |
194 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34450828 |
gtgttgatggattcttcaaagtatgtgcactctaaagttattttttcttcaatggggtgaaatatcaaacaattataaggtacattaccaataatttttt |
34450927 |
T |
 |
| Q |
195 |
taagaaaattgcagcaaattct |
216 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34450928 |
taagaaaattgcagcaaattct |
34450949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 11 - 92
Target Start/End: Original strand, 32742065 - 32742146
Alignment:
| Q |
11 |
gattatactatatatttgtataccaaatgaaaagatagtgggggcaccagcccacatactactgaacgtagttccgctcctg |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
32742065 |
gattatactatatatttgtataccaaatgaaaagatagtgggggcaccagcccacatactactcaacgtagctccgcccctg |
32742146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 11 - 92
Target Start/End: Complemental strand, 19473844 - 19473763
Alignment:
| Q |
11 |
gattatactatatatttgtataccaaatgaaaagatagtgggggcaccagcccacatactactgaacgtagttccgctcctg |
92 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
19473844 |
gattatactatatattggtataccgaatgaaaagatagtgggggcaccagcccacataccactgaacgtagctccgcccctg |
19473763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 11 - 68
Target Start/End: Original strand, 11832453 - 11832510
Alignment:
| Q |
11 |
gattatactatatatttgtataccaaatgaaaagatagtgggggcaccagcccacata |
68 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11832453 |
gattatactatatatttatataccgaatgaaaagatagtgggggcaccagcccacata |
11832510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University