View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8733_low_2 (Length: 233)
Name: NF8733_low_2
Description: NF8733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8733_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 11 - 217
Target Start/End: Complemental strand, 33863361 - 33863144
Alignment:
| Q |
11 |
attattctaaaaaatctatcgtgcaaaccagaacgaactttgacattgaagtattgtccgtgaatgaaggtgctgattttccccctcactttatggttca |
110 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33863361 |
attatttttaaaaatctatcgtgcaaaccagaacgaactttgacattgaagtattgtccgtgaatgaaggtgctgattttccccctcactttatggttca |
33863262 |
T |
 |
| Q |
111 |
acattcttaatttctttattaat-ctttagt----------ttaatttaacaagcttcaatgaaatctctaggtgttgtttgatgtcctcaactcccaag |
199 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||| |||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33863261 |
acattcttaatttctttattaatactttagtttaagattaattaatttaacaaccttcgatgaaatctctaggtgttgtgtgatgtcctcaactcccaag |
33863162 |
T |
 |
| Q |
200 |
tcaactattagtgctgtc |
217 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
33863161 |
tcaactatcagtgctgtc |
33863144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University