View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8736_low_3 (Length: 444)
Name: NF8736_low_3
Description: NF8736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8736_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 11 - 428
Target Start/End: Original strand, 34533242 - 34533658
Alignment:
| Q |
11 |
gtttggtggttatgttagaggagttttggtacgagcaacaagttgttgtttttaatgttggcactttatgttggagattagtgagtttgacttttgcttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
34533242 |
gtttggtggttatgttagaggagttttggtacgagcaacaagttgttgtttttaatgttggcactttacgttggagattagagagtttgacttttgcttt |
34533341 |
T |
 |
| Q |
111 |
tggagttgaaattgatttttgtgt-atagattttatggttttggtggtcgccttatgtagagggtgtttttggttggtttatcggatgttttattgtttg |
209 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34533342 |
tggagttgaaattgatttttgtgtaatagattttatggttttggtggtagccctatgtagagggtgtttttggttggtttgtcggatgttttattgtttg |
34533441 |
T |
 |
| Q |
210 |
tgtcttgcttgtctctattcaccttgaatagggactttgtcttttaataaattttcttgttnnnnnnnnnnncaaaattaaataaagagaaagaaagaac |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34533442 |
tgtcttgcttgtctctattcaccttgaatagtgactttatcttttaataaattttcttgtt--aaaaaaaaacaaaattaaataaagagaaagaaagaac |
34533539 |
T |
 |
| Q |
310 |
tccagaagtaaggagatttgtggctccacaaagacacagactctcgtccaaccatcaatcgaccccctcattacgaaggggcgacatgggaggagggatc |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34533540 |
tccagaagtaaggagatttgtggctccacaaagacgcagactctcgtccgaccatcaatcgaccccctcattacgaaggggcgacatgggaggagggatc |
34533639 |
T |
 |
| Q |
410 |
aactgcccaaggaagaaat |
428 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34533640 |
aactgcccaaggaagaaat |
34533658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University