View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8736_low_6 (Length: 297)
Name: NF8736_low_6
Description: NF8736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8736_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 40941972 - 40942235
Alignment:
| Q |
18 |
aagtgtttagcattaagttcactgaaaatcaaagcagcaatcacttatattatatggtgagaagtcttgtttatgatcatgattgttgaacaagtacacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40941972 |
aagtgtttagcattaagttcactgaaaatcaaagcagcaatcacttat--tatatggtgagaagtcttgtttatgatcatgattgttgaacaagtacacc |
40942069 |
T |
|
| Q |
118 |
ttccttttatggtaattaaactcttcattgcaagc----catgcactttgagctggaataatcttagatggaattagtag--------tacttacaagtt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40942070 |
ttccttttatggtaattaaactcttcattacaagccatgcatgcactttgagcttaaataatcttagatggaattagtagtatcaatctacttacaagtt |
40942169 |
T |
|
| Q |
206 |
cttaaagtacgatcttaatttattattactagcaaatatttacttaagatgtgggagtaagtcaca |
271 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942170 |
cttaaagtactatcttaatttattattactagcaaatatttacttaagatgtgggagtaagtcaca |
40942235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 110
Target Start/End: Original strand, 40951458 - 40951548
Alignment:
| Q |
18 |
aagtgtttagcattaagttcactgaaaa-tcaaagcagcaatcacttatattatatggtgagaagtcttgtttatgatcatgattgttgaacaa |
110 |
Q |
| |
|
|||| |||||||| |||||||||| ||| ||||||||||||||||||||| | ||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
40951458 |
aagtatttagcatcaagttcactggaaagtcaaagcagcaatcacttataat---tggtgagaagtcttgttaatgataatgattgttgaacaa |
40951548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 65
Target Start/End: Original strand, 40947717 - 40947762
Alignment:
| Q |
21 |
tgtttagcattaagttcactgaaa-atcaaagcagcaatcacttat |
65 |
Q |
| |
|
||||||||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
40947717 |
tgtttagcaataagttcactggaatatcaaagcagcaatcacttat |
40947762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University