View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8737_high_1 (Length: 636)
Name: NF8737_high_1
Description: NF8737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8737_high_1 |
 |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0811 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-149; HSPs: 118)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 13 - 300
Target Start/End: Complemental strand, 22552094 - 22551807
Alignment:
| Q |
13 |
attatactaggaagctgaaacaattgatgcctatgttagttattgattgatcttctatgttttgaaaaaattacattcttgatatatttggtacattaat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22552094 |
attatactaggaagctgaaacaattgatgcctatgttagttattgattgatcttctatgttttgaaaaaattacattcttgatatatttggtacattaac |
22551995 |
T |
 |
| Q |
113 |
taatttttgtatgaaagtggcttacaaaatatgaagtgggagcaaaaccaaatccaccaaagaagccaagaagatcgccaaagaaagggaatgtaacccc |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22551994 |
taattcttgtatgaaagtggcttacaaaatatgaagtgggagcaaaaccaaatccaccaaagaagccaagaagatcgccaaagaaagggaatgtaacccc |
22551895 |
T |
 |
| Q |
213 |
aataaaaagtgtaaaagctgcaacaaattaacaagatggttgttacttaaaaaatttgagttaaacacatttttaatgtttataaaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
22551894 |
aataaaaagtgtaaaagctgcaacaaattaacaagatggttgttgcttaaaaaaattgagttaaacacgtttttaatgtttataaaat |
22551807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 160; E-Value: 6e-85
Query Start/End: Original strand, 295 - 551
Target Start/End: Complemental strand, 22551521 - 22551261
Alignment:
| Q |
295 |
taaaatctcttatgaagtttagcccggacaaatatttttatcgatgctaataccataatatgatatgcttagaacatcaaatatttttgttgggaaaaat |
394 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22551521 |
taaaatctcttatgaagtttagcctggacaaatatttttatcgatgctaagaccataatatgatatgcttagaacatcaaatatttttgttgggaaaaat |
22551422 |
T |
 |
| Q |
395 |
attttttatgctctttacaaagtcaatagcttttttgatgtctcgcatcaaacatgctattgacatcaagcactttattttcaaatcgtt----nnnnnn |
490 |
Q |
| |
|
||||||||||||||||| |||||||||||| | ||||||||||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
22551421 |
attttttatgctctttataaagtcaatagcatgtttgatgtctcaggtcaaacatgctattaacatcaagcactttatttataaatcgttaaaaaaaaaa |
22551322 |
T |
 |
| Q |
491 |
nntgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgtac |
551 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
22551321 |
aaagctaaaatatggttttagtctctgtaaatatgttttgttttggttttagtctctgtac |
22551261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 42207243 - 42207299
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42207243 |
gctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgta |
42207299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 9179594 - 9179650
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
9179594 |
gctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgta |
9179650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 10744053 - 10743997
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
10744053 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgta |
10743997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 38496781 - 38496727
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
38496781 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
38496727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 4736541 - 4736485
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
4736541 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgta |
4736485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 14318046 - 14318102
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
14318046 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccttgta |
14318102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 26133412 - 26133356
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
26133412 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
26133356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 36577723 - 36577779
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
36577723 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
36577779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 38786160 - 38786216
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
38786160 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
38786216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 40029142 - 40029198
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
40029142 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgta |
40029198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 24781990 - 24782045
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
24781990 |
gctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24782045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 494 - 543
Target Start/End: Original strand, 38962807 - 38962856
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
38962807 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 45139 - 45195
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
45139 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
45195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 1381248 - 1381304
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
1381248 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
1381304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 2217495 - 2217551
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
2217495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
2217551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 4203769 - 4203713
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
4203769 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
4203713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 5950177 - 5950233
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
5950177 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
5950233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 7075573 - 7075629
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
7075573 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
7075629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 9179919 - 9179863
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
9179919 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgta |
9179863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 11799457 - 11799401
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
11799457 |
gctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgta |
11799401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 18046039 - 18046095
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
18046039 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
18046095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 20661310 - 20661254
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
20661310 |
gctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgta |
20661254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 20683748 - 20683804
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||| |||||||||||||| |
|
|
| T |
20683748 |
gctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgta |
20683804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 21124914 - 21124970
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
21124914 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgta |
21124970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||| ||||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct |
27850320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 28863511 - 28863567
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
28863511 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
28863567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 28863837 - 28863781
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
28863837 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
28863781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 29366948 - 29366892
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
29366948 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
29366892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 29692745 - 29692801
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
29692745 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
29692801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 30800495 - 30800551
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
30800495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
30800551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 30800849 - 30800793
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
30800849 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
30800793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 30888161 - 30888217
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
30888161 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
30888217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 33336025 - 33335969
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
33336025 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgta |
33335969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 34125631 - 34125575
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
34125631 |
gctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgta |
34125575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 35928457 - 35928401
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
35928457 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
35928401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 36578082 - 36578026
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
36578082 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
36578026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 37271360 - 37271416
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
37271360 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgta |
37271416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 40029496 - 40029440
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
40029496 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
40029440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 40168007 - 40167951
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
40168007 |
gctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgta |
40167951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 6912855 - 6912800
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
6912800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 28550828 - 28550883
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
28550828 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28550883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 29172523 - 29172578
Alignment:
| Q |
493 |
tgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
29172523 |
tgctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 545
Target Start/End: Complemental strand, 39379609 - 39379558
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
39379609 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
39379558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 498 - 548
Target Start/End: Complemental strand, 3850594 - 3850544
Alignment:
| Q |
498 |
aaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
3850594 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 5917127 - 5917181
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
5917127 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 9532532 - 9532478
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgta |
9532478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 18633600 - 18633654
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
18633600 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18633654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 19565468 - 19565522
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
19565468 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 19685018 - 19685072
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
19685018 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 25561706 - 25561760
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
25561706 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
25561760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 29172885 - 29172831
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
29172885 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 29875724 - 29875670
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
29875724 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29875670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 35167164 - 35167110
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
35167164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 35876689 - 35876743
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
35876689 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 2217853 - 2217800
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
2217853 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
2217800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 493 - 550
Target Start/End: Original strand, 27916461 - 27916518
Alignment:
| Q |
493 |
tgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||| | ||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
27916461 |
tgctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctgta |
27916518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 2032939 - 2032883
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||| ||||||||||||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
2032939 |
gctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtccatgta |
2032883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 3851328 - 3851272
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | |||||||| |||||||| |||||||||||||| |
|
|
| T |
3851328 |
gctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgta |
3851272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 5614167 - 5614223
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| ||||||||| |||| |
|
|
| T |
5614167 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgta |
5614223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 5614529 - 5614473
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
5614529 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
5614473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 10743725 - 10743781
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
10743725 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
10743781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 12144908 - 12144964
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
12144908 |
gctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgta |
12144964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 15635379 - 15635431
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||| || |||||||| | ||||||||||||||||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctg |
15635431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 16038378 - 16038434
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
16038378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
16038434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 18046347 - 18046291
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
18046347 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
18046291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 18258526 - 18258470
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
18258526 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgta |
18258470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 19685379 - 19685323
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
19685379 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
19685323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 20690734 - 20690790
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
20690734 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgta |
20690790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 21050912 - 21050856
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||||||||||| |
|
|
| T |
21050912 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgta |
21050856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 23381951 - 23382007
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| | |||||||||||||| |||||| |
|
|
| T |
23381951 |
gctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgta |
23382007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 24443743 - 24443687
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
24443743 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
24443687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 25779161 - 25779105
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||| ||||||||||||| |||||| |
|
|
| T |
25779161 |
gctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgta |
25779105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 26133184 - 26133240
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
26133184 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgta |
26133240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 29693089 - 29693033
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||| |||| |
|
|
| T |
29693089 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttgta |
29693033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 31037740 - 31037684
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||| || ||||| |
|
|
| T |
31037740 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttattctctgta |
31037684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 32108809 - 32108865
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||| |||||| |||||||| |
|
|
| T |
32108809 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgta |
32108865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 35609304 - 35609360
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
35609304 |
gctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgta |
35609360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 35877051 - 35876995
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||| ||||||| |
|
|
| T |
35877051 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgta |
35876995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 36973709 - 36973653
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
36973709 |
gctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgta |
36973653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 38170515 - 38170571
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
38170515 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
38170571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 40167787 - 40167843
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||| ||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
40167787 |
gctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
40167843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 537
Target Start/End: Original strand, 4736206 - 4736249
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggt |
537 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
4736206 |
gctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 519 - 550
Target Start/End: Complemental strand, 32109071 - 32109040
Alignment:
| Q |
519 |
aaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32109071 |
aaatatgtttcgttttggttttagtccctgta |
32109040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 1105147 - 1105093
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
1105147 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 1287042 - 1286988
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| || ||||||||||||| |||||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgta |
1286988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 1381610 - 1381556
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
1381610 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 5917459 - 5917405
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
5917459 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 6118498 - 6118444
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||| |||||| |
|
|
| T |
6118498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
6118444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 6912498 - 6912552
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
6912498 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 10408929 - 10408983
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||||||||| |
|
|
| T |
10408929 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
10408983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 11799130 - 11799184
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | ||||||||||||||||||| |
|
|
| T |
11799130 |
gctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 15635706 - 15635652
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
15635706 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
15635652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 18633960 - 18633906
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||| |||||| |
|
|
| T |
18633960 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctg |
18633906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 19565830 - 19565776
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
19565830 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 546
Target Start/End: Complemental strand, 20418013 - 20417963
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccc |
546 |
Q |
| |
|
||||||||||||| ||||| || |||||||| |||||||| |||||||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccc |
20417963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 35166157 - 35166103
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||| ||||||||||||||| || ||| |||| ||||||||||||||||||||| |
|
|
| T |
35166157 |
gctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg |
35166103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 35928065 - 35928119
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
35928065 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 37271705 - 37271651
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||| |||||||||||| |
|
|
| T |
37271705 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 40764416 - 40764470
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
40764416 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 496 - 541
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggtttta |
541 |
Q |
| |
|
|||||||||||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 543
Target Start/End: Original strand, 4203457 - 4203506
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
4203457 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 543
Target Start/End: Original strand, 36973354 - 36973403
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
|||||||||||||||| |||| | |||||||| |||||||||||||||| |
|
|
| T |
36973354 |
gctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 293829 - 293885
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| ||||||||| |||| |
|
|
| T |
293829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccatgta |
293885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 1104859 - 1104915
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||| |||||||||||||| |
|
|
| T |
1104859 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgta |
1104915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 5904009 - 5904065
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || ||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
5904009 |
gctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgta |
5904065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 13990894 - 13990838
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||| |||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
13990894 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
13990838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 17070862 - 17070806
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | |||||||| ||||||| ||||||| ||||||| |
|
|
| T |
17070862 |
gctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctgta |
17070806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 20660949 - 20661005
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
20660949 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccttgta |
20661005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 21050576 - 21050632
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| | ||||||| ||||||||| |||||||||||||| |
|
|
| T |
21050576 |
gctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgta |
21050632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 29855614 - 29855670
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| ||| ||||||| || |||||||||||||||||||| |
|
|
| T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgta |
29855670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 30888430 - 30888374
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| ||||||| | |||||||| | ||||||||||||||||| ||||| |
|
|
| T |
30888430 |
gctaaaatatgattttagtatccgtaaatatatctcgttttggttttagtctctgta |
30888374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 34125308 - 34125364
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
34125308 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
34125364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 495 - 543
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
||||||||||||||| ||| || |||||||| |||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 39379242 - 39379294
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||| |||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
39379294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 42553643 - 42553699
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
42553643 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgta |
42553699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 1e-24; HSPs: 142)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 128 - 246
Target Start/End: Original strand, 41896200 - 41896318
Alignment:
| Q |
128 |
agtggcttacaaaatatgaagtgggagcaaaaccaaatccaccaaagaagccaagaagatcgccaaagaaagggaatgtaaccccaataaaaagtgtaaa |
227 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||| || | ||||||| || | |||||| |
|
|
| T |
41896200 |
agtgccttacaaaatatgacgtgggagcaaaaccaaatccaccaaagaacccaagaagatctccaaagaaaggaaaactcaccccaaataataatgtaaa |
41896299 |
T |
 |
| Q |
228 |
agctgcaacaaattaacaa |
246 |
Q |
| |
|
||||| |||| || ||||| |
|
|
| T |
41896300 |
agctgaaacatatcaacaa |
41896318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 133 - 197
Target Start/End: Original strand, 41890593 - 41890657
Alignment:
| Q |
133 |
cttacaaaatatgaagtgggagcaaaaccaaatccaccaaagaagccaagaagatcgccaaagaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
41890593 |
cttacaaaatatgaagtgggagcaaaaccaaatccaccaaagaatccaagaagatcaccaaagaa |
41890657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 6567495 - 6567439
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
6567495 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
6567439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 7867130 - 7867186
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||| ||||||||||||||| |
|
|
| T |
7867130 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgta |
7867186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 14007490 - 14007546
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
14007490 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
14007546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 494 - 549
Target Start/End: Complemental strand, 3753571 - 3753516
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
3753571 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
3753516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 21391097 - 21391152
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
21391097 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
21391152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 26207280 - 26207335
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgta |
26207335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 10887234 - 10887288
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||||||||| |
|
|
| T |
10887234 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 12158691 - 12158745
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
12158691 |
gctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 13260320 - 13260266
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
13260320 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 31258340 - 31258394
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
31258340 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
31258394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 45290458 - 45290512
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
45290458 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
45290512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 19622656 - 19622709
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
19622656 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
19622709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 497 - 550
Target Start/End: Complemental strand, 24649656 - 24649603
Alignment:
| Q |
497 |
aaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
24649603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 493 - 550
Target Start/End: Original strand, 39303674 - 39303731
Alignment:
| Q |
493 |
tgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||||| || || ||||| ||||||||||||||||||||||| |
|
|
| T |
39303674 |
tgctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgta |
39303731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 3247199 - 3247255
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
3247199 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
3247255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 3753214 - 3753270
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
3753270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 8140435 - 8140491
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
8140435 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
8140491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 10631165 - 10631221
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
10631165 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
10631221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 11822364 - 11822308
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
11822364 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgta |
11822308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 12360967 - 12360911
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
12360967 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
12360911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 13259989 - 13260045
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
13259989 |
gctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgta |
13260045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 13770490 - 13770546
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
13770490 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
13770546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 15211512 - 15211568
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
15211512 |
gctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgta |
15211568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 18302386 - 18302330
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
18302386 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
18302330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 19720713 - 19720769
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
19720713 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
19720769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 22919685 - 22919741
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
22919685 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
22919741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 26191360 - 26191416
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||| |||| |
|
|
| T |
26191360 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgta |
26191416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 26191733 - 26191677
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
26191733 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
26191677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 26442564 - 26442620
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
26442564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccatgta |
26442620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 26442898 - 26442842
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
26442898 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgta |
26442842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 27521577 - 27521633
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
27521633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 29072498 - 29072554
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
29072498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
29072554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 32626530 - 32626586
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
32626530 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
32626586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 34002939 - 34002883
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| | ||||||||||||||||||||| |
|
|
| T |
34002939 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgta |
34002883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 35308110 - 35308054
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
35308110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
35308054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 37625026 - 37624970
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtctctgta |
37624970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 39747834 - 39747778
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
39747834 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
39747778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 45368491 - 45368547
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
45368491 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
45368547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 48609237 - 48609293
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
48609237 |
gctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgta |
48609293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 48609593 - 48609537
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
48609593 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcactgta |
48609537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 50428874 - 50428930
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||||||| ||||| |||||||| |
|
|
| T |
50428874 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgta |
50428930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 1810928 - 1810983
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
1810928 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
1810983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 4789310 - 4789365
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
4789365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 545
Target Start/End: Original strand, 33067349 - 33067400
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||||||||| |||| |
|
|
| T |
33067349 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 45368847 - 45368792
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgta |
45368792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 990378 - 990324
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
990378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
990324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 7001896 - 7001842
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
7001896 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7001842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 15526361 - 15526307
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
15526361 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 18473273 - 18473327
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
18473273 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18473327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 18899842 - 18899896
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
18899896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 18900130 - 18900076
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgta |
18900076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 20756022 - 20756076
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||| ||||| || |||||||||||| |||||||||||||||||| |||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagtccttgta |
20756076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 24977779 - 24977833
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
24977779 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 26061957 - 26062011
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
26061957 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26062011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 30322930 - 30322984
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
30322930 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 32729048 - 32728994
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
32729048 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
32728994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 33000668 - 33000614
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
33000668 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 34808200 - 34808254
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgta |
34808254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 35056531 - 35056585
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
35056531 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 37545629 - 37545683
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
37545629 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 40718111 - 40718165
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
40718111 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 41358370 - 41358424
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
41358370 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41358424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 41358662 - 41358608
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||| |||| |
|
|
| T |
41358662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
41358608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 41881094 - 41881148
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
41881094 |
gctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg |
41881148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 45380273 - 45380327
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
45380273 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 45638581 - 45638635
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
45638581 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 46868576 - 46868522
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||||||||||||||||||| |
|
|
| T |
46868576 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
46868522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 10887597 - 10887544
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||||||| |
|
|
| T |
10887597 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 18473594 - 18473541
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
18473594 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 33379889 - 33379942
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
33379889 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
33379942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 44641079 - 44641132
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 49073692 - 49073745
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||| |||||||||||||| ||||| |
|
|
| T |
49073692 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 3679627 - 3679683
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
3679627 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgta |
3679683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 7819102 - 7819046
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| ||| || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
7819102 |
gctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgta |
7819046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 11822005 - 11822061
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
11822005 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
11822061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 12322969 - 12322913
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||| |||||||| |
|
|
| T |
12322969 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgta |
12322913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 12361012 - 12361068
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||| || ||||||||||||||||||||||| |
|
|
| T |
12361012 |
gctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgta |
12361068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 21383105 - 21383161
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
21383105 |
gctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgta |
21383161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 22919976 - 22919920
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||| |||||||||| |||| |
|
|
| T |
22919976 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtccttgta |
22919920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 22953555 - 22953507
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttag |
542 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||| |
|
|
| T |
22953555 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 24507842 - 24507786
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
24507842 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
24507786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 26062255 - 26062203
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || ||||||||||||| |||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctg |
26062203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 29072861 - 29072805
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||| ||||||||||||||||||| |
|
|
| T |
29072861 |
gctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgta |
29072805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 32454293 - 32454237
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||| ||||||||||||| |
|
|
| T |
32454293 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgta |
32454237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 33045689 - 33045633
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
33045689 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
33045633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 33067729 - 33067673
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| ||| |||||||| |||||||||||||| | |||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggttttaattcctgta |
33067673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 34383243 - 34383187
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
34383243 |
gctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtccctgta |
34383187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 35307716 - 35307772
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
35307716 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
35307772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 38151211 - 38151155
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
38151211 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
38151155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 44157696 - 44157752
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
44157752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 44641431 - 44641375
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
44641431 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
44641375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 48956065 - 48956009
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | ||||||||||||||||||||| |
|
|
| T |
48956065 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgta |
48956009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 49923817 - 49923761
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| |||| || ||||||| ||||||||| |||||||||||||| |
|
|
| T |
49923817 |
gctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgta |
49923761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 50429208 - 50429152
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
50429208 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
50429152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 50799131 - 50799187
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
50799131 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
50799187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 52254478 - 52254422
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||||||||||| |
|
|
| T |
52254478 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
52254422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 541
Target Start/End: Original strand, 15334918 - 15334965
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggtttta |
541 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
15334918 |
gctaaaatatggttttaatctctgtaaatatgactcgttttggtttta |
15334965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 519 - 550
Target Start/End: Original strand, 24509968 - 24509999
Alignment:
| Q |
519 |
aaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24509968 |
aaatatgtttcgttttggttttagtccctgta |
24509999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 545
Target Start/End: Complemental strand, 35005743 - 35005692
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
35005743 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 546
Target Start/End: Original strand, 46183686 - 46183737
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccc |
546 |
Q |
| |
|
||||||||||||||| ||| || ||||||| |||||||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
46183737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 990089 - 990143
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
990089 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
990143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 4617091 - 4617145
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||||||| ||||||||| ||||| |
|
|
| T |
4617091 |
taaaatatggttttggtccctgaaaatatgtttcgttttagttttagtctctgta |
4617145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 8364619 - 8364673
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||||||||||| ||||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgta |
8364673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 10631527 - 10631473
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
10631527 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 19623016 - 19622962
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||| || || ||||||| ||||||||||||||||||||| |
|
|
| T |
19623016 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
19622962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 24649351 - 24649405
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||| ||||| |
|
|
| T |
24649351 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg |
24649405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 24653803 - 24653857
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
24653803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 24654166 - 24654112
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||| ||||| |
|
|
| T |
24654166 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
24654112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 31060788 - 31060842
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| | ||||||||||||||||||| |
|
|
| T |
31060788 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 35005445 - 35005499
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||||||||| |
|
|
| T |
35005445 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 38164294 - 38164240
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
38164294 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 41739119 - 41739066
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
41739119 |
gctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgta |
41739066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 45290819 - 45290765
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
45290819 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
45290765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 47819233 - 47819287
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
47819233 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 47819595 - 47819541
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
47819595 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 540
Target Start/End: Complemental strand, 49074052 - 49074006
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggtttt |
540 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||| |||| |
|
|
| T |
49074052 |
gctaaaatatggttttggtccttgtaaatatgcttcgttttgatttt |
49074006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 496 - 545
Target Start/End: Original strand, 7350426 - 7350475
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||| || |||||||| || ||||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 493 - 550
Target Start/End: Original strand, 15058418 - 15058475
Alignment:
| Q |
493 |
tgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| ||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
15058418 |
tgctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccttgta |
15058475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 496 - 549
Target Start/End: Complemental strand, 21391371 - 21391318
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||| ||||||||| |||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagttttagtctctgt |
21391318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 29688427 - 29688374
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
||||||||||||||||| || || ||||||| |||||||||||||||||||| |
|
|
| T |
29688427 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct |
29688374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 498 - 550
Target Start/End: Original strand, 2939934 - 2939986
Alignment:
| Q |
498 |
aaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||| || || ||||||| ||||||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgta |
2939986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 3247559 - 3247507
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 4323829 - 4323885
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||||| ||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgta |
4323885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 4360625 - 4360569
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||| |||||||| ||||||| |
|
|
| T |
4360625 |
gctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctgta |
4360569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 7867356 - 7867300
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| | |||||||||||||||||||| |
|
|
| T |
7867356 |
gctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgta |
7867300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 12322605 - 12322661
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || ||||||||||||||||| ||||||||| |||| |
|
|
| T |
12322605 |
gctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtccttgta |
12322661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 16060884 - 16060828
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
16060884 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
16060828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 18079399 - 18079455
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||| |||||| ||| ||| ||||||| || |||||||||||||||||||| |
|
|
| T |
18079399 |
gctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgta |
18079455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 20948756 - 20948812
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| |||||| |||||||||||||||| |
|
|
| T |
20948756 |
gctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgta |
20948812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 25658015 - 25658071
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| |||||||||||||| |||||||| |
|
|
| T |
25658015 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgta |
25658071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 26324586 - 26324642
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
26324586 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
26324642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 26324946 - 26324890
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
26324946 |
gctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtctctgta |
26324890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 31258699 - 31258647
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||| || ||||||| ||||||| ||||||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg |
31258647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 33000306 - 33000362
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||| |||||||||||||| |
|
|
| T |
33000306 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgta |
33000362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 33234547 - 33234603
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
33234547 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
33234603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 42482980 - 42483036
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| || |||||||||||||| ||||| |
|
|
| T |
42482980 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgta |
42483036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 52254184 - 52254240
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || ||||||| |||||||||||||||||| |||| |
|
|
| T |
52254184 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgta |
52254240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 2e-17; HSPs: 154)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 45521833 - 45521779
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
45521833 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgta |
45521779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 46622128 - 46622074
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
46622128 |
gctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 494 - 551
Target Start/End: Original strand, 16123140 - 16123197
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgtac |
551 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
16123140 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgtac |
16123197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 5345688 - 5345632
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
5345688 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
5345632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 9863403 - 9863347
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
9863403 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgta |
9863347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 22008527 - 22008583
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
22008527 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
22008583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 22016045 - 22016101
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
22016045 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
22016101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 53701662 - 53701606
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
53701662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
53701606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 26799889 - 26799943
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
26799889 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
26799943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 39436719 - 39436773
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
39436719 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39436773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 51834941 - 51834887
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
51834941 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
51834887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 499 - 548
Target Start/End: Complemental strand, 8510523 - 8510474
Alignment:
| Q |
499 |
aatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
8510474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 493 - 550
Target Start/End: Original strand, 9596758 - 9596815
Alignment:
| Q |
493 |
tgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| |||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
9596758 |
tgctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgta |
9596815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 495 - 544
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc |
16679727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 43440496 - 43440549
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||| |||||||||||| |
|
|
| T |
43440496 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct |
43440549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 494 - 543
Target Start/End: Original strand, 46901105 - 46901154
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
46901105 |
gctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 1721451 - 1721395
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
1721451 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgta |
1721395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 4034718 - 4034774
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
4034718 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
4034774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 4513264 - 4513320
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
4513264 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
4513320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 4513619 - 4513563
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
4513619 |
gctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgta |
4513563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 4950038 - 4950094
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
4950038 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
4950094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 7956870 - 7956926
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| | |||||| |
|
|
| T |
7956870 |
gctaaaatatggttttggtctttgtaaatatgcttcattttggttttaattcctgta |
7956926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 12673645 - 12673701
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
12673645 |
gctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgta |
12673701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 12741270 - 12741214
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
12741270 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
12741214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 25710869 - 25710813
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
25710869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
25710813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 26090077 - 26090021
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
26090077 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
26090021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 29678025 - 29678081
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
29678025 |
gctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgta |
29678081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 30034471 - 30034415
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30034471 |
gctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgta |
30034415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 30130159 - 30130215
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
30130159 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
30130215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 31869955 - 31869899
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||| ||||||||||||||| |
|
|
| T |
31869955 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgta |
31869899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 45002384 - 45002328
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
45002384 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgta |
45002328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 46186770 - 46186714
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
46186770 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgta |
46186714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 47336580 - 47336524
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
47336580 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
47336524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 48924239 - 48924183
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
48924239 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgta |
48924183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 51550445 - 51550389
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
51550445 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
51550389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 54608862 - 54608806
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
54608862 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
54608806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 545
Target Start/End: Original strand, 34238599 - 34238650
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
34238599 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34238650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 50196301 - 50196356
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
50196356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 474045 - 474099
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
474045 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 863649 - 863595
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| ||| || ||||||||||||||||| |||||||||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgta |
863595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 1721092 - 1721146
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||| || |||||||||||||||||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgta |
1721146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 3152110 - 3152056
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
3152110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3152056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 10976979 - 10977033
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
10976979 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
10977033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 12740908 - 12740962
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
12740908 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 15979339 - 15979393
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
15979339 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 544
Target Start/End: Original strand, 20611021 - 20611071
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
20611021 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 20612897 - 20612843
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
20612897 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
20612843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 22155930 - 22155984
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| |||||||||||| |
|
|
| T |
22155930 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22155984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 22156292 - 22156238
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22156238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 26089731 - 26089785
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
26089731 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 28427246 - 28427300
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
28427246 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg |
28427300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 28427607 - 28427553
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
28427607 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28427553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 30552477 - 30552423
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||| ||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
30552477 |
gctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 35569133 - 35569079
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
35569079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 37506868 - 37506922
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
37506868 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37506922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 37507221 - 37507167
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
37507221 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 544
Target Start/End: Original strand, 39288574 - 39288624
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
39288574 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 39437108 - 39437054
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
39437108 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
39437054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 40169653 - 40169599
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| |||||||||||| |
|
|
| T |
40169653 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
40169599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 47336229 - 47336283
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
47336229 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 546
Target Start/End: Original strand, 47901803 - 47901853
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccc |
546 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
47901803 |
taaaatatggttttagtctctggaaatatgcatcgttttggttttagtccc |
47901853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 544
Target Start/End: Original strand, 51500399 - 51500449
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||| |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
51500399 |
gctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 51834609 - 51834663
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
51834609 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51834663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 543
Target Start/End: Complemental strand, 275832 - 275783
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
275832 |
gctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt |
275783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 3151751 - 3151804
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
3151751 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 4814897 - 4814845
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| | | |||||||| |||||||||||||||||||| |
|
|
| T |
4814897 |
gctaaaatatggttttagtcct-gcaaatatgtctcgttttggttttagtccct |
4814845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 3830135 - 3830191
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
3830135 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
3830191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 3830515 - 3830459
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
3830515 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
3830459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 9597094 - 9597038
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || ||||||| |||||||||||||||||||||||| |
|
|
| T |
9597094 |
gctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgta |
9597038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 546
Target Start/End: Original strand, 14772212 - 14772264
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccc |
546 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||| |
|
|
| T |
14772212 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
14772264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 15979700 - 15979644
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
15979700 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgta |
15979644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 21159454 - 21159510
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| ||||||||| |||| |
|
|
| T |
21159454 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgta |
21159510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 21159816 - 21159760
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
21159816 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
21159760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 25609768 - 25609824
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| |||||| ||||| | ||||||||||||||||||||||| |
|
|
| T |
25609768 |
gctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgta |
25609824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 25615976 - 25616032
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
25615976 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
25616032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 498 - 550
Target Start/End: Original strand, 25710515 - 25710567
Alignment:
| Q |
498 |
aaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
25710515 |
aaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
25710567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 28418899 - 28418843
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||| |||||| |||||||||||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgta |
28418843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 28452148 - 28452204
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||| | |||||||||||||||| |||| |
|
|
| T |
28452148 |
gctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgta |
28452204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 29445955 - 29446011
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
29445955 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
29446011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 29446205 - 29446149
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| | |||||||||||||||| |||| |
|
|
| T |
29446205 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgta |
29446149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 29490742 - 29490686
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
29490742 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgta |
29490686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 30268506 - 30268562
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
30268506 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
30268562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 31480137 - 31480193
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
31480137 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
31480193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 44802283 - 44802339
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
44802283 |
gctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgta |
44802339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 45313862 - 45313806
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||| |||||||||||||| |
|
|
| T |
45313862 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgta |
45313806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 45320978 - 45320922
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
45320978 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
45320922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 46724901 - 46724845
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||| |||||| |||||||||||||| |
|
|
| T |
46724901 |
gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctgta |
46724845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 47005155 - 47005211
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||| ||||||||||||||| |
|
|
| T |
47005155 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgta |
47005211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 49323783 - 49323839
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
49323783 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
49323839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 50261935 - 50261879
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| || ||||||||||| |||||||||||||| ||||| |
|
|
| T |
50261935 |
gctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtctctgta |
50261879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 51759820 - 51759876
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| |||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
51759820 |
gctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgta |
51759876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 52342582 - 52342526
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
52342582 |
gctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtccatgta |
52342526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 54767172 - 54767228
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| ||| || |||||| ||| |||||||||||||||||||| |
|
|
| T |
54767172 |
gctaaaatatggttttattctctgaaaatatattttcttttggttttagtccctgta |
54767228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 541
Target Start/End: Original strand, 4814541 - 4814588
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggtttta |
541 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
4814541 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 15016389 - 15016444
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | |||||||||||||||||||| |
|
|
| T |
15016389 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
15016444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 19297947 - 19297892
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
19297947 |
ctaaaatatagttttggtccttgtaaatatgtctcgttttgtttttagtctctgta |
19297892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 545
Target Start/End: Original strand, 29525106 - 29525157
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||| |||||||||| |
|
|
| T |
29525106 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 29955300 - 29955355
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||| |||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
29955355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 30004454 - 30004509
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||| |||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
30004509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 30034109 - 30034164
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggttttaatccttgta |
30034164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 31869596 - 31869651
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| | || |||||||| ||||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgta |
31869651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 545
Target Start/End: Complemental strand, 34238914 - 34238863
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
34238914 |
gctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtcc |
34238863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 49670802 - 49670747
Alignment:
| Q |
494 |
gctaaaatatggttttagtctt-tgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
49670802 |
gctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg |
49670747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 474407 - 474353
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||| |||| |
|
|
| T |
474407 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 8510215 - 8510269
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| || |||||||||||||||||| |
|
|
| T |
8510215 |
gctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg |
8510269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 13584366 - 13584312
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | ||||||||||||||||||| |
|
|
| T |
13584366 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
13584312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 14633888 - 14633834
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||| ||||||||||||| || |||||||| | ||||||||||||||||||| |
|
|
| T |
14633888 |
gctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
14633834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 544
Target Start/End: Original strand, 15286157 - 15286207
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
||||||||||||||||| || || ||||||| |||||||||||||||||| |
|
|
| T |
15286157 |
gctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 516 - 550
Target Start/End: Original strand, 20907160 - 20907194
Alignment:
| Q |
516 |
tgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20907160 |
tgtaaatatgtctcgttttggttttagtccctgta |
20907194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 22008889 - 22008835
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
22008889 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 28452375 - 28452321
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| | ||||||| |||||||||||||||||||||| |
|
|
| T |
28452375 |
gctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 28552382 - 28552328
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
28552382 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 28942904 - 28942850
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
28942904 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
28942850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 36672966 - 36673020
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| |||| || |||||||| | ||||||||||||||| ||||| |
|
|
| T |
36672966 |
taaaatatggttttggtctctgcaaatatgtcttgttttggttttagtctctgta |
36673020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 519 - 549
Target Start/End: Original strand, 39132568 - 39132598
Alignment:
| Q |
519 |
aaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39132568 |
aaatatgtttcgttttggttttagtccctgt |
39132598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 39288897 - 39288843
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||| || || ||||||| ||||||||||||||||||||| |
|
|
| T |
39288897 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
39288843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 40169345 - 40169399
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||| || || |||||||| |||||||| |||||||||||| |
|
|
| T |
40169345 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg |
40169399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 43441271 - 43441325
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||| |||| |
|
|
| T |
43441271 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 45161116 - 45161170
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||| |||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgta |
45161170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 51500684 - 51500630
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
51500684 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 51550083 - 51550137
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
51550083 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 54608519 - 54608573
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
54608519 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 14633547 - 14633600
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||| ||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctg |
14633600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 543
Target Start/End: Complemental strand, 40279334 - 40279285
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||| | |||||| ||||||| |
|
|
| T |
40279334 |
gctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagt |
40279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 543
Target Start/End: Original strand, 45313501 - 45313550
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
||||||||||| |||| ||| ||||||||||| ||||||||| ||||||| |
|
|
| T |
45313501 |
gctaaaatatgattttggtccttgtaaatatgattcgttttgattttagt |
45313550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 496 - 545
Target Start/End: Original strand, 53632506 - 53632555
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||| | |||||||| |||||||| |||||||||| |
|
|
| T |
53632506 |
taaaatatggttttagtccctataaatatggttcgttttagttttagtcc |
53632555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| || || |||||||| ||||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 3387603 - 3387547
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
3387603 |
gctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccatgta |
3387547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 495 - 543
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
|||||||||||||||| || || |||||||| |||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 7957225 - 7957169
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
7957225 |
gctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgta |
7957169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 9261790 - 9261846
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
9261790 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
9261846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 546
Target Start/End: Complemental strand, 9262154 - 9262102
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccc |
546 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||| |
|
|
| T |
9262154 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
9262102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 11463233 - 11463289
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || ||||||| ||||||||||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgta |
11463289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 19656542 - 19656598
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| ||||||||| |||| |
|
|
| T |
19656542 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccttgta |
19656598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 19844580 - 19844524
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
19844580 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
19844524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 20757774 - 20757718
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| ||||| || |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
20757774 |
gctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtctctgta |
20757718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 27681681 - 27681625
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| | |||| || ||||||| |||||||||||||| |||||||| |
|
|
| T |
27681681 |
gctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgta |
27681625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 28552022 - 28552078
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||| ||||||||||||||| |
|
|
| T |
28552022 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgta |
28552078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 29686545 - 29686601
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||| ||||||||||| ||| || |||||||| | ||||||||||||||||||||| |
|
|
| T |
29686545 |
gctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgta |
29686601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 498 - 550
Target Start/End: Complemental strand, 29955661 - 29955609
Alignment:
| Q |
498 |
aaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
29955661 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
29955609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 498 - 550
Target Start/End: Complemental strand, 30004816 - 30004764
Alignment:
| Q |
498 |
aaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
30004816 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
30004764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 30106219 - 30106163
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
30106219 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgta |
30106163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 30128285 - 30128341
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||| |||| |||||||||||||||| |||||| |
|
|
| T |
30128285 |
gctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgta |
30128341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 30424629 - 30424685
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| | ||||| ||||||||| ||||| |
|
|
| T |
30424629 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtctctgta |
30424685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 35498417 - 35498473
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||| ||||||| | ||||||| ||||||||||||||| |||||||| |
|
|
| T |
35498417 |
gctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctgta |
35498473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 39132905 - 39132849
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| | ||||||| |||||||||| |
|
|
| T |
39132905 |
gctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctgta |
39132849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 40277823 - 40277879
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||| ||||||| ||| || ||||||| ||||||||||||||| |||||||| |
|
|
| T |
40277823 |
gctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctgta |
40277879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 546
Target Start/End: Complemental strand, 40370588 - 40370536
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccc |
546 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||| |
|
|
| T |
40370588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40370536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 40545565 - 40545621
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||| ||||||||||||||| |
|
|
| T |
40545565 |
gctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgta |
40545621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 40979709 - 40979653
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || ||||||| |||||||||||||| |||||||| |
|
|
| T |
40979709 |
gctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgta |
40979653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 46751272 - 46751328
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || ||||||| |||||||||||||||||| |||| |
|
|
| T |
46751272 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgta |
46751328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 50196656 - 50196600
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||| ||||||||||||||| |
|
|
| T |
50196656 |
gctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgta |
50196600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 2e-17; HSPs: 140)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 19831511 - 19831565
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
19831511 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgta |
19831565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 29865510 - 29865454
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
29865510 |
gctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgta |
29865454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 41693675 - 41693731
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
41693675 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
41693731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 146689 - 146633
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
146689 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgta |
146633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 2265396 - 2265340
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2265396 |
gctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgta |
2265340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 3838263 - 3838207
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
3838207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 11713486 - 11713542
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
11713486 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
11713542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 11788415 - 11788359
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
11788415 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
11788359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 36622251 - 36622307
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
36622251 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
36622307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 43592047 - 43592103
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
43592047 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
43592103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 5790898 - 5790844
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
5790898 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 19183783 - 19183837
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
19183783 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19183837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 26813867 - 26813921
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
26813867 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26813921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 494 - 551
Target Start/End: Original strand, 9195055 - 9195112
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgtac |
551 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||| ||||||| |
|
|
| T |
9195055 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtac |
9195112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 1497611 - 1497667
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
1497611 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgta |
1497667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 4424184 - 4424128
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
4424184 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
4424128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 10375068 - 10375012
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||| |||||||| |
|
|
| T |
10375068 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgta |
10375012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 10671940 - 10671884
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
10671940 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
10671884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 13215061 - 13215117
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
13215061 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
13215117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 20939324 - 20939268
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
20939268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 496 - 544
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 24483401 - 24483457
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgta |
24483457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 24483890 - 24483834
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
24483890 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
24483834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 25705086 - 25705142
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
25705086 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
25705142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 25954116 - 25954172
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||||||||||| |||| |
|
|
| T |
25954116 |
gctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtccttgta |
25954172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 33732863 - 33732919
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
33732863 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
33732919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 36815489 - 36815545
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36815489 |
gctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgta |
36815545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 40302338 - 40302282
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
40302338 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgta |
40302282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 40786461 - 40786517
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
40786461 |
gctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgta |
40786517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 43671935 - 43671991
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||||||| |||||| |
|
|
| T |
43671935 |
gctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctgta |
43671991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 44559063 - 44559119
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
44559063 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
44559119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 44985983 - 44985927
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
44985983 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgta |
44985927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 41791020 - 41791075
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgta |
41791075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 44985623 - 44985678
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
44985678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 545
Target Start/End: Complemental strand, 45442695 - 45442644
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||| |||||||||||||||||| |
|
|
| T |
45442695 |
gctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 2481194 - 2481248
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| || ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
2481194 |
gctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 7814247 - 7814301
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
7814247 |
gctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg |
7814301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 14003410 - 14003464
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
14003410 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 16900205 - 16900151
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
16900205 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16900151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 16993596 - 16993542
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
16993596 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16993542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 19184150 - 19184096
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
19184150 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19184096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 20131318 - 20131372
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
20131318 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 25954423 - 25954369
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgta |
25954369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 26238816 - 26238870
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
26238870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 26239159 - 26239105
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| |||||||||||| |
|
|
| T |
26239159 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 26814228 - 26814174
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
26814228 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26814174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 30215423 - 30215477
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
30215423 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 33576116 - 33576062
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
33576116 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 37271740 - 37271794
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
37271740 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37271794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 37272101 - 37272047
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
37272101 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37272047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 544
Target Start/End: Original strand, 38639413 - 38639463
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
38639413 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 38980252 - 38980198
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
38980252 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38980198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 41451838 - 41451892
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
41451838 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 42358702 - 42358756
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
42358756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 43789191 - 43789137
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
43789191 |
gctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg |
43789137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| || ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 493 - 550
Target Start/End: Original strand, 10374774 - 10374831
Alignment:
| Q |
493 |
tgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
10374774 |
tgctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
10374831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 27311068 - 27311015
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
27311068 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 497 - 550
Target Start/End: Complemental strand, 36806892 - 36806839
Alignment:
| Q |
497 |
aaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
36806839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 42695869 - 42695922
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||||||| |
|
|
| T |
42695869 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
42695922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 2481556 - 2481500
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
2481556 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
2481500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 542
Target Start/End: Original strand, 3832273 - 3832321
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttag |
542 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
3832273 |
gctaaaatatgattttagttcttgtaaatatgtttggttttggttttag |
3832321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 496 - 544
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 3837934 - 3837990
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| || |||||||| ||||||| ||||||||||||||| |
|
|
| T |
3837934 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgta |
3837990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 4423896 - 4423952
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
4423896 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
4423952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 7121307 - 7121252
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| |||| |||||||||| |||| |
|
|
| T |
7121307 |
gctaaaatatggttttagtcct-gtaaatatgtttcattttagttttagtccttgta |
7121252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 8046330 - 8046386
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || ||||||| ||||||||||||||||||||||| |
|
|
| T |
8046330 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgta |
8046386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 8046647 - 8046591
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
8046647 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgta |
8046591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 9195205 - 9195149
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| | || ||||||| ||||||||||||||||||||||| |
|
|
| T |
9195205 |
gctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgta |
9195149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 10664985 - 10665041
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| | |||||||||||| |
|
|
| T |
10664985 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgta |
10665041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 10665293 - 10665237
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| |||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
10665293 |
gctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgta |
10665237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 10671631 - 10671687
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||| | ||||||||||||||||||||||| |
|
|
| T |
10671631 |
gctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgta |
10671687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 11713844 - 11713788
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||| |||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
11713844 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
11713788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 16522992 - 16523048
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
16522992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
16523048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 16523324 - 16523268
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
16523324 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
16523268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 17302142 - 17302086
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
17302142 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgta |
17302086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 22881614 - 22881670
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
22881614 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
22881670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 26707874 - 26707930
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || |||||| |||||||||||||||||||||||| |
|
|
| T |
26707874 |
gctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgta |
26707930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 29182169 - 29182225
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| ||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
29182169 |
gctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtctctgta |
29182225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 29859871 - 29859815
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
29859871 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
29859815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 29865222 - 29865278
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
29865278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 31326251 - 31326195
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
31326251 |
gctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgta |
31326195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 31644842 - 31644898
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
31644842 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgta |
31644898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 32691314 - 32691370
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| | || ||||||| |||||||||||||| |||||||| |
|
|
| T |
32691314 |
gctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgta |
32691370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 36815834 - 36815778
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
36815834 |
gctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgta |
36815778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 37228734 - 37228790
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
37228734 |
gctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtctctgta |
37228790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 37911119 - 37911063
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||| |||||||| |
|
|
| T |
37911119 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgta |
37911063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 38731830 - 38731886
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
38731830 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
38731886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 41694002 - 41693946
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
41694002 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
41693946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 41791311 - 41791255
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||| |||| ||||| |
|
|
| T |
41791311 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtctctgta |
41791255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 43597155 - 43597211
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
43597155 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgta |
43597211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 43597498 - 43597442
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
43597498 |
gctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgta |
43597442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 43672317 - 43672261
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || |||||||||| ||||||||||||||||||||| |
|
|
| T |
43672317 |
gctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgta |
43672261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 43710707 - 43710651
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||| | ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
43710707 |
gctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgta |
43710651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 519 - 550
Target Start/End: Complemental strand, 1295521 - 1295490
Alignment:
| Q |
519 |
aaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1295521 |
aaatatgtttcgttttggttttagtccctgta |
1295490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 3671004 - 3671059
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| ||||||||||||| |
|
|
| T |
3671004 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt |
3671059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 498 - 549
Target Start/End: Complemental strand, 3671187 - 3671136
Alignment:
| Q |
498 |
aaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
3671187 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3671136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 545
Target Start/End: Complemental strand, 17541775 - 17541724
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
||||||||||||||||| || || |||||||| |||||||||||||||||| |
|
|
| T |
17541775 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
17541724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 38979890 - 38979945
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtt-tcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||| || ||||||||||||||||||||| |
|
|
| T |
38979890 |
gctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctg |
38979945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 545
Target Start/End: Original strand, 43788859 - 43788910
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
43788859 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
43788910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 44559407 - 44559352
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||| ||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgta |
44559352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 541
Target Start/End: Original strand, 45442317 - 45442364
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggtttta |
541 |
Q |
| |
|
||||||||||||||||||||| || |||||||| |||||||| ||||| |
|
|
| T |
45442317 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 4794131 - 4794185
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||| |
|
|
| T |
4794131 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 5334752 - 5334806
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
5334752 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 5335039 - 5334985
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
5335039 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 5790559 - 5790613
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||| |||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
5790559 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
5790613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 14003741 - 14003687
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
14003741 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 14392791 - 14392845
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| |||||| ||| |||| |
|
|
| T |
14392791 |
taaaatatggttttagtcattgtaaatatgcctcgttttagttttaatccttgta |
14392845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 15842822 - 15842768
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
15842822 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 16673412 - 16673466
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| || |||||||||||||||||| |
|
|
| T |
16673412 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 17541383 - 17541437
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
17541383 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
17541437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 20131680 - 20131626
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
20131680 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 24358617 - 24358671
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
24358617 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 25705448 - 25705394
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
25705448 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 33575753 - 33575807
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||| |
|
|
| T |
33575753 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 499 - 545
Target Start/End: Original strand, 35155298 - 35155344
Alignment:
| Q |
499 |
aatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
35155344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 44073806 - 44073752
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||||||||| |
|
|
| T |
44073806 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
44073752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 33733240 - 33733187
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||| ||||| |
|
|
| T |
33733240 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 1138358 - 1138302
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||| ||||||||||||||| |
|
|
| T |
1138358 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgta |
1138302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 3172531 - 3172475
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| ||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
3172531 |
gctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtccatgta |
3172475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 12835326 - 12835382
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
12835326 |
gctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgta |
12835382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 13850523 - 13850579
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||| ||| || |||||||| ||| ||||||||||||||||||| |
|
|
| T |
13850523 |
gctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgta |
13850579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 544
Target Start/End: Original strand, 17912452 - 17912500
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
||||||||| |||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
17912500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 18113090 - 18113146
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| | ||||||||||||||||||||| |
|
|
| T |
18113090 |
gctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgta |
18113146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 18113453 - 18113397
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| | ||||||| ||||||||||||||| |||||||| |
|
|
| T |
18113453 |
gctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgta |
18113397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 20658062 - 20658118
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||| |||||||||||| || ||||||| | ||||||||||||||||||||| |
|
|
| T |
20658062 |
gctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgta |
20658118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 23732327 - 23732272
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| ||||||||| ||||||||||||| |
|
|
| T |
23732327 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctgta |
23732272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 27310877 - 27310932
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||| ||||||||||||| |
|
|
| T |
27310877 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctgta |
27310932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 30215870 - 30215814
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||| | |||||||||||||||||||||| |
|
|
| T |
30215870 |
gctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgta |
30215814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 31226076 - 31226020
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || ||||||| |||||||||||||| |||||||| |
|
|
| T |
31226076 |
gctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgta |
31226020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 31325921 - 31325977
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| ||||| || ||||||| ||||||| ||||||||||||||| |
|
|
| T |
31325921 |
gctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgta |
31325977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 34317799 - 34317855
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
34317799 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
34317855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 34964158 - 34964102
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||| ||||||| ||||||| |
|
|
| T |
34964158 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctgta |
34964102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 35155618 - 35155562
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| | |||||| |||||||||||||| |
|
|
| T |
35155618 |
gctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgta |
35155562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 495 - 543
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 40301976 - 40302032
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| || |||| ||||||||||||||| |
|
|
| T |
40301976 |
gctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgta |
40302032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 44994060 - 44994004
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||||| ||||||||| ||||| |
|
|
| T |
44994060 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtctctgta |
44994004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 3e-16; HSPs: 123)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 1974010 - 1974066
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
1974010 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
1974066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 44403248 - 44403195
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||||||||||||||||||| |
|
|
| T |
44403248 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct |
44403195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 5308324 - 5308380
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||| ||||||||||||||| |
|
|
| T |
5308324 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgta |
5308380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 10358367 - 10358311
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
10358367 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
10358311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 19561449 - 19561393
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
19561449 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
19561393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 23817033 - 23816977
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||| ||||| |||||| |
|
|
| T |
23817033 |
gctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgta |
23816977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 35210514 - 35210458
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
35210514 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
35210458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 39832907 - 39832963
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
39832907 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
39832963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 44344788 - 44344732
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
44344788 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
44344732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 46304383 - 46304327
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
46304383 |
gctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
46304327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 32189388 - 32189333
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgta |
32189333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 497 - 550
Target Start/End: Original strand, 37372441 - 37372494
Alignment:
| Q |
497 |
aaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
37372494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 489071 - 489015
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| ||||||||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
489071 |
gctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgta |
489015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 5354769 - 5354825
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
5354769 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgta |
5354825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 12894401 - 12894345
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
12894401 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
12894345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 13769775 - 13769831
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
13769775 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
13769831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 17999720 - 17999664
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
17999720 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
17999664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 19757749 - 19757805
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
19757749 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
19757805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 25547489 - 25547433
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
25547489 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
25547433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 27458400 - 27458456
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
27458400 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
27458456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 28911905 - 28911849
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
28911905 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
28911849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 35838336 - 35838280
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
35838336 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
35838280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 17854151 - 17854206
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || |||||||| || |||||||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgta |
17854206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 496 - 547
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 37952671 - 37952726
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| ||||||||||| | |||||||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctgta |
37952726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 41364885 - 41364940
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
||||||||||||||||| ||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
41364885 |
gctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgt |
41364940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 496 - 547
Target Start/End: Complemental strand, 45671545 - 45671494
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||||||| |||||||||||| |
|
|
| T |
45671545 |
taaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct |
45671494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 1006836 - 1006890
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
1006836 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1006890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 1614560 - 1614614
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
1614560 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 5233809 - 5233863
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
5233809 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 6108335 - 6108389
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
6108335 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
6108389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 8144296 - 8144350
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
8144296 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 14739003 - 14738949
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||| |||||||||||| |
|
|
| T |
14739003 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
14738949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 23399975 - 23399921
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
23399975 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 25092161 - 25092215
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
25092161 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 25988386 - 25988440
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
25988386 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 26877679 - 26877733
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
26877679 |
gctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 39520727 - 39520673
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgta |
39520673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 44508721 - 44508775
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
44508721 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 44509053 - 44508999
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
44509053 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 543
Target Start/End: Complemental strand, 48359074 - 48359025
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
48359074 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 1614903 - 1614847
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
1614903 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
1614847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 3975550 - 3975606
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
3975550 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
3975606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 5234203 - 5234147
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
5234203 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgta |
5234147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 6079810 - 6079866
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
6079866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 6509209 - 6509265
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||| ||||||||||||||| |
|
|
| T |
6509209 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgta |
6509265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 6509469 - 6509413
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
6509469 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgta |
6509413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 8555798 - 8555742
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||| |||||||| |
|
|
| T |
8555798 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
8555742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 9659688 - 9659632
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
9659688 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
9659632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 11767274 - 11767218
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||| |||||||||||||||||||| |
|
|
| T |
11767274 |
gctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgta |
11767218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 16853588 - 16853532
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
16853588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
16853532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 17999466 - 17999522
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||| ||||||||| |
|
|
| T |
17999466 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgta |
17999522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 19783816 - 19783872
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
19783816 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
19783872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 20388275 - 20388331
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | ||||||||||||||||||||| |
|
|
| T |
20388275 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgta |
20388331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 21223406 - 21223462
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| |||||||||||||||||| ||||| |
|
|
| T |
21223406 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctgta |
21223462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 23816671 - 23816727
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
23816671 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgta |
23816727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 28528906 - 28528962
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
28528906 |
gctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgta |
28528962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 28911578 - 28911634
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||| ||||||||||||||| |
|
|
| T |
28911578 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgta |
28911634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 35469881 - 35469937
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||||||||||||||||||||| ||||| |
|
|
| T |
35469881 |
gctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgta |
35469937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 35837925 - 35837981
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
35837925 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgta |
35837981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 37372903 - 37372847
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
37372903 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgta |
37372847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 496 - 544
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 39520399 - 39520455
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
39520399 |
gctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgta |
39520455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 39719641 - 39719585
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||| ||||||||||||||| |
|
|
| T |
39719641 |
gctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgta |
39719585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 39833235 - 39833179
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
39833235 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgta |
39833179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 493 - 545
Target Start/End: Original strand, 43300612 - 43300664
Alignment:
| Q |
493 |
tgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
43300612 |
tgctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 45073640 - 45073584
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
45073640 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
45073584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 45228917 - 45228861
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
45228917 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
45228861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 46648714 - 46648658
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||||||||| ||| |||| |
|
|
| T |
46648714 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggttttaatccttgta |
46648658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 46759659 - 46759715
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
46759659 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgta |
46759715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 46759941 - 46759885
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
46759941 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgta |
46759885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 46828945 - 46829001
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| | ||||||||||||||||||||| |
|
|
| T |
46828945 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgta |
46829001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 48854069 - 48854013
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
48854069 |
gctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgta |
48854013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 6847117 - 6847062
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||| ||| || ||||||| |||||||||||||||||| ||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtctctgta |
6847062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 20355768 - 20355721
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttag |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
20355768 |
ctaaaatatggttttagtccccgtaaatatgtttcgttttagttttag |
20355721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 544
Target Start/End: Original strand, 7431952 - 7432002
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
7431952 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 8144657 - 8144603
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
8144657 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 23399613 - 23399667
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
23399613 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 23676451 - 23676397
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
23676451 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 25988748 - 25988694
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
25988748 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 26878070 - 26878016
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
26878070 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 29198304 - 29198358
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||| | ||||||||||||||||||||| |
|
|
| T |
29198304 |
gctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 29198661 - 29198607
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
29198661 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 30223462 - 30223516
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
30223462 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 544
Target Start/End: Complemental strand, 30709643 - 30709593
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
||||||||||| |||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
30709643 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 31503423 - 31503477
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| | | ||||||||||| || |||||||||||||||||||| |
|
|
| T |
31503423 |
taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgta |
31503477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 31503780 - 31503726
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || |||||||| |||||||| |||||||| ||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtctctgta |
31503726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 35015219 - 35015165
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||||||||| |
|
|
| T |
35015219 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35015165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 544
Target Start/End: Original strand, 39438742 - 39438792
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
39438742 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 39439028 - 39438974
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||| || ||||||||||||||||||||| |
|
|
| T |
39439028 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 44568689 - 44568635
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||| |
|
|
| T |
44568689 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 45671217 - 45671271
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || |||||||| ||||||| |||||||| |||||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctgta |
45671271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 48192487 - 48192433
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
48192487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 543
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
|||||||||||||||||||| | |||||||| |||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 543
Target Start/End: Original strand, 19561155 - 19561204
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
19561155 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 21223747 - 21223694
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
21223747 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 493 - 550
Target Start/End: Complemental strand, 37527422 - 37527365
Alignment:
| Q |
493 |
tgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| ||| | |||||||| | ||||||||||||||||||||| |
|
|
| T |
37527422 |
tgctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgta |
37527365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 499 - 539
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
499 |
aatatggttttagtctttgtaaatatgtttcgttttggttt |
539 |
Q |
| |
|
||||||||||||||| ||| |||||||| |||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 1559704 - 1559648
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||| |||||||||||||| |
|
|
| T |
1559704 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgta |
1559648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 6911083 - 6911139
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || ||||||||| |||||||| ||||||||| |||| |
|
|
| T |
6911083 |
gctaaaatatgattttggtccttataaatatgtctcgttttgattttagtccttgta |
6911139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 10358002 - 10358058
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| | |||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
10358002 |
gctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgta |
10358058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 13770080 - 13770024
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||| |||||| |
|
|
| T |
13770080 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgta |
13770024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 14543711 - 14543767
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| || ||||||||||||||| |||| |
|
|
| T |
14543711 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccatgta |
14543767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 18022703 - 18022647
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
18022703 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgta |
18022647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 18311581 - 18311637
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||||| | ||||||| |||||||||||||| || ||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggttttattctctgta |
18311637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 19465979 - 19465924
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| | | | |||||||| |||||| |||||||||||||||| |
|
|
| T |
19465979 |
gctaaaatatggttttagccct-gcaaatatgtctcgtttcggttttagtccctgta |
19465924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 20388674 - 20388618
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| ||||||| |||||| |
|
|
| T |
20388674 |
gctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctgta |
20388618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 21554394 - 21554450
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
21554394 |
gctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtccttgta |
21554450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 21554752 - 21554696
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | |||||| |||||||||||||| |
|
|
| T |
21554752 |
gctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgta |
21554696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 540
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggtttt |
540 |
Q |
| |
|
|||||||||||||| |||| || |||||||| ||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 30223794 - 30223738
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
30223794 |
gctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgta |
30223738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 30352563 - 30352615
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||||||||||| |||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg |
30352615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 31310366 - 31310422
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || |||||| | ||||||||||||||||| ||||| |
|
|
| T |
31310366 |
gctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctgta |
31310422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 31732102 - 31732158
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| ||||| |||||||| |
|
|
| T |
31732102 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgta |
31732158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 498 - 550
Target Start/End: Complemental strand, 35104290 - 35104238
Alignment:
| Q |
498 |
aaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
35104290 |
aaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
35104238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 35665878 - 35665934
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || | ||||||| ||||||||||||||||||||||| |
|
|
| T |
35665878 |
gctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgta |
35665934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 41054235 - 41054179
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
41054235 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
41054179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 44402961 - 44403017
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | |||||||||||||||||||| |
|
|
| T |
44402961 |
gctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgta |
44403017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 44958505 - 44958449
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
44958505 |
gctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgta |
44958449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 45073315 - 45073371
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||| | |||||||||||||| |||||||| |
|
|
| T |
45073315 |
gctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgta |
45073371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 46829311 - 46829255
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| || |||||||||||||||||||| |
|
|
| T |
46829311 |
gctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgta |
46829255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 3e-16; HSPs: 104)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 33131849 - 33131793
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
33131849 |
gctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgta |
33131793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 10091039 - 10091093
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
10091093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 493 - 550
Target Start/End: Original strand, 23770161 - 23770218
Alignment:
| Q |
493 |
tgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
23770161 |
tgctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
23770218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 318096 - 318040
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
318096 |
gctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgta |
318040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 14428651 - 14428707
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
14428707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 14656259 - 14656203
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
14656259 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgta |
14656203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 25431853 - 25431797
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
25431853 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
25431797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 30928682 - 30928738
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
30928682 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
30928738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 14428948 - 14428893
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccttgta |
14428893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 19267566 - 19267621
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
19267566 |
gctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgt |
19267621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 3414751 - 3414697
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
3414751 |
gctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 7324189 - 7324135
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
7324135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 12176640 - 12176586
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
12176586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 14655380 - 14655434
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
14655380 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
14655434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 15962028 - 15962082
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
15962028 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 18024014 - 18024068
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgta |
18024068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 34990312 - 34990258
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
34990258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 1007125 - 1007181
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
1007125 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgta |
1007181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 10910630 - 10910686
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| |||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
10910630 |
gctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgta |
10910686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 10910963 - 10910907
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
10910963 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
10910907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 11449168 - 11449112
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
11449168 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgta |
11449112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 15722611 - 15722667
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| |||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
15722611 |
gctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgta |
15722667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 15962388 - 15962332
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
15962388 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
15962332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 17771912 - 17771968
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||| |||| |
|
|
| T |
17771912 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgta |
17771968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 19690394 - 19690450
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
19690394 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
19690450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 21995424 - 21995368
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
21995424 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgta |
21995368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 23502539 - 23502483
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||| |||||||| |
|
|
| T |
23502539 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgta |
23502483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 25121495 - 25121439
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
25121495 |
gctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgta |
25121439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 34582530 - 34582586
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
34582530 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
34582586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 6468311 - 6468366
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
6468311 |
gctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgt |
6468366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 3968646 - 3968700
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
3968646 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 6412219 - 6412273
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
6412219 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 7156159 - 7156105
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
7156159 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7156105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 15076203 - 15076149
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
15076203 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15076149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 21385252 - 21385306
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
21385252 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 22543717 - 22543663
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
22543717 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 24274130 - 24274076
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
24274130 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24274076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 24692978 - 24692924
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| |||||||||||| |
|
|
| T |
24692978 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 26376042 - 26375988
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
26375988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 31166871 - 31166925
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
31166925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 33801742 - 33801688
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
33801742 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33801688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 33808621 - 33808675
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
33808621 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
33808675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 1214995 - 1214942
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||||||| |
|
|
| T |
1214995 |
gctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 317813 - 317869
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| || |||||||| ||||||||||||||| ||||||| |
|
|
| T |
317813 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctgta |
317869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 494406 - 494462
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
494406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
494462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 494751 - 494695
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||| ||| |||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgta |
494695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 1007508 - 1007452
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
1007508 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
1007452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 1890062 - 1890114
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
1890114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 3276353 - 3276297
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
3276353 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgta |
3276297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 3356143 - 3356199
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
3356143 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccttgta |
3356199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 3414388 - 3414444
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
3414388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
3414444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 3969008 - 3968952
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
3969008 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
3968952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 546
Target Start/End: Original strand, 11448538 - 11448590
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccc |
546 |
Q |
| |
|
||||||||||| |||||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
11448538 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccc |
11448590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 12176386 - 12176442
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
12176386 |
gctaaaatatggttttagcccatgtaaatatgtctcgttttagttttagtccatgta |
12176442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 12757611 - 12757667
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
12757611 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcactgta |
12757667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 14655904 - 14655960
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||| |||||||| ||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
14655904 |
gctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgta |
14655960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 18024374 - 18024318
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| | ||||||||||||||||||||| |
|
|
| T |
18024374 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgta |
18024318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 19296406 - 19296350
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||| |||||||| |
|
|
| T |
19296406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
19296350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 21147405 - 21147461
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
21147405 |
gctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgta |
21147461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 21993788 - 21993844
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
21993788 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgta |
21993844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 21995065 - 21995121
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || | ||||| ||||||||||||||||||||||| |
|
|
| T |
21995065 |
gctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgta |
21995121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 23628799 - 23628855
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||| ||||||||||||||||||| ||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtcactgta |
23628855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 25136995 - 25137051
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
25136995 |
gctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgta |
25137051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 25137356 - 25137300
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
25137356 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
25137300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 25431577 - 25431633
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| ||||| || |||||||||||||||||||| ||||||| |||||| |
|
|
| T |
25431577 |
gctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctgta |
25431633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 26375694 - 26375750
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || |||||||| |||||||||||||| |||||||| |
|
|
| T |
26375694 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgta |
26375750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 30929043 - 30928987
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
30929043 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
30928987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 34582891 - 34582835
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
34582891 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgta |
34582835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 497 - 548
Target Start/End: Original strand, 543365 - 543416
Alignment:
| Q |
497 |
aaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
543416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 496 - 547
Target Start/End: Complemental strand, 3356495 - 3356444
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3356444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 545
Target Start/End: Complemental strand, 9896636 - 9896585
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| || |||||||| | |||||||||||||||| |
|
|
| T |
9896636 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 13617531 - 13617586
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgta |
13617586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 1890451 - 1890397
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||||||||| |
|
|
| T |
1890451 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
1890397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 7155798 - 7155852
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||| ||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
7155798 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7155852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 544
Target Start/End: Complemental strand, 8170150 - 8170100
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||| |
|
|
| T |
8170150 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 8680776 - 8680830
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
8680776 |
gctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8680830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 8681115 - 8681061
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | ||||||||||||||||||| |
|
|
| T |
8681115 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
8681061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 12419937 - 12419883
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||| || || ||||||| ||||||||||||||||||||| |
|
|
| T |
12419937 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
12419883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 497 - 543
Target Start/End: Original strand, 19275044 - 19275090
Alignment:
| Q |
497 |
aaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
||||||||||||||| || || | ||||||||||||||||||||||| |
|
|
| T |
19275044 |
aaaatatggttttaggctctgcagatatgtttcgttttggttttagt |
19275090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 21994402 - 21994348
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
21994402 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 22543355 - 22543409
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
22543355 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 22822650 - 22822596
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||||||||| |
|
|
| T |
22822650 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
22822596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 24273829 - 24273883
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
24273829 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 544
Target Start/End: Original strand, 24901240 - 24901290
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||| |
|
|
| T |
24901240 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 31167199 - 31167145
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||||||||| |
|
|
| T |
31167199 |
gctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg |
31167145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 31198616 - 31198670
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
31198616 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 32885674 - 32885728
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||| || || ||||||| ||||||||||||||||||||| |
|
|
| T |
32885674 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
32885728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 2615873 - 2615926
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
2615873 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
2615926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||||| || ||||||| || |||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
5286896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 543
Target Start/End: Complemental strand, 11926032 - 11925983
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
|||||||||||||||| |||| || |||||||| ||||||||||||||| |
|
|
| T |
11926032 |
gctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagt |
11925983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 543
Target Start/End: Original strand, 17765010 - 17765059
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||| |
|
|
| T |
17765010 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 543
Target Start/End: Original strand, 22822308 - 22822357
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
22822308 |
gctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 30239294 - 30239347
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
||||||||||| ||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
30239294 |
gctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 2373180 - 2373236
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | ||||||||| ||||||||||| |
|
|
| T |
2373180 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgta |
2373236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 495 - 543
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
|||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 12299139 - 12299083
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
12299139 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgta |
12299083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 12612358 - 12612302
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||| |||||| || ||||||| ||||||| ||||||||||||||| |
|
|
| T |
12612358 |
gctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgta |
12612302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 13150749 - 13150693
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||| ||| | || |||||||| ||||||||||||||||||||||| |
|
|
| T |
13150749 |
gctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctgta |
13150693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 19129519 - 19129463
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
19129519 |
gctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgta |
19129463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 19267911 - 19267855
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || ||||||||||| | |||||||||||||||||||| |
|
|
| T |
19267911 |
gctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgta |
19267855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 19296109 - 19296165
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||| |||||||||||| || ||||||| |||||||| |||||||||||||| |
|
|
| T |
19296109 |
gctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgta |
19296165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 546
Target Start/End: Complemental strand, 22792898 - 22792846
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccc |
546 |
Q |
| |
|
|||||||||||||| ||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
22792898 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc |
22792846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 30479421 - 30479365
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || ||||||| ||||||||||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgta |
30479365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 31398540 - 31398484
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || |||||||| || ||||||||||||||| |||| |
|
|
| T |
31398540 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtccttgta |
31398484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 3e-16; HSPs: 155)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 28809012 - 28809068
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
28809012 |
gctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgta |
28809068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 52442091 - 52442035
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
52442091 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgta |
52442035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 43368467 - 43368522
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
43368522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 8760780 - 8760724
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
8760780 |
gctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgta |
8760724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 13479610 - 13479554
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
13479610 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
13479554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 13764806 - 13764750
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
13764806 |
gctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtccatgta |
13764750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 19321858 - 19321802
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
19321858 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgta |
19321802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 22584288 - 22584344
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
22584288 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctctgta |
22584344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 22584606 - 22584550
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||| |||||||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
22584606 |
gctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgta |
22584550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 45593585 - 45593529
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
45593585 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgta |
45593529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 55072390 - 55072446
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
55072390 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
55072446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 18831176 - 18831121
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgta |
18831121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 30564835 - 30564890
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgta |
30564890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 9289267 - 9289321
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
9289267 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 35415300 - 35415354
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35415300 |
gctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
35415354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 41620255 - 41620201
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
41620255 |
gctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
41620201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 46088059 - 46088005
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
46088059 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
46088005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 50714564 - 50714510
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
50714564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
50714510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 24474962 - 24474909
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
24474962 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
24474909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 7642651 - 7642595
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| || | |||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
7642651 |
gctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctgta |
7642595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 9446322 - 9446266
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
9446322 |
gctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgta |
9446266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 13064464 - 13064408
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
13064464 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
13064408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 13073760 - 13073816
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
13073760 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
13073816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 13631229 - 13631285
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
13631229 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
13631285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 16712690 - 16712634
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
16712690 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
16712634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 22099911 - 22099855
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
22099911 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgta |
22099855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 25423925 - 25423981
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
25423925 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
25423981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 25424311 - 25424255
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
25424311 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
25424255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 498 - 550
Target Start/End: Complemental strand, 27008401 - 27008349
Alignment:
| Q |
498 |
aaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgta |
27008349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 29380909 - 29380853
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
29380909 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
29380853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 34361804 - 34361860
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
34361804 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
34361860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 35464019 - 35464075
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
35464019 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
35464075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 36702001 - 36702057
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
36702001 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
36702057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 52017506 - 52017562
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
52017506 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
52017562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 52017869 - 52017813
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
52017869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
52017813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 52430099 - 52430043
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||| ||||||||||||||| |
|
|
| T |
52430099 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgta |
52430043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 52441764 - 52441820
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
52441764 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
52441820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 53717173 - 53717117
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
53717173 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
53717117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 18205521 - 18205466
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
18205466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 549
Target Start/End: Complemental strand, 32365482 - 32365427
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
32365482 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
32365427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 35420701 - 35420646
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgta |
35420646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 545
Target Start/End: Complemental strand, 41921083 - 41921032
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||||||||||||| |
|
|
| T |
41921083 |
gctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc |
41921032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 496 - 547
Target Start/End: Original strand, 47022743 - 47022794
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||| |||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 5797484 - 5797538
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||| |||| |||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgta |
5797538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 544
Target Start/End: Original strand, 6827547 - 6827597
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
6827547 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 498 - 548
Target Start/End: Complemental strand, 9289634 - 9289584
Alignment:
| Q |
498 |
aaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
9289634 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 14791805 - 14791751
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
14791805 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 25358539 - 25358485
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||| |||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
25358539 |
gctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 35415632 - 35415578
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
35415632 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35415578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 35763648 - 35763702
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
35763648 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35763702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 38054549 - 38054603
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
38054603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 41345854 - 41345908
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
41345854 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41345908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 41439790 - 41439844
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || ||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
41439790 |
taaaatatggttttagcctctgtaaatatttctcgttttggttttagtctctgta |
41439844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 43231089 - 43231143
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
43231089 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 46115778 - 46115724
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||| || ||||||||||||||||||||| |
|
|
| T |
46115778 |
gctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 46128912 - 46128858
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||| || ||||||||||||||||||||| |
|
|
| T |
46128912 |
gctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 47023104 - 47023050
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
47023104 |
gctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 51545966 - 51545912
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
51545912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 493 - 550
Target Start/End: Original strand, 11285503 - 11285560
Alignment:
| Q |
493 |
tgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
11285503 |
tgctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
11285560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 13479273 - 13479326
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||| ||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccct |
13479326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 496 - 545
Target Start/End: Original strand, 18135793 - 18135841
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||| | ||||||||| ||||||||||||||||||| |
|
|
| T |
18135793 |
taaaatatggttttagtcct-gtaaatatgcttcgttttggttttagtcc |
18135841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 18205157 - 18205210
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
18205157 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18205210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 28809179 - 28809126
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
28809179 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 29420536 - 29420483
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||||||| |
|
|
| T |
29420536 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 32208543 - 32208596
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
32208543 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
32208596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 493 - 550
Target Start/End: Complemental strand, 44925845 - 44925788
Alignment:
| Q |
493 |
tgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| |||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
44925845 |
tgctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgta |
44925788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 496 - 545
Target Start/End: Original strand, 49123000 - 49123048
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||| | ||||||||| ||||||||||||||||||| |
|
|
| T |
49123000 |
taaaatatggttttagtcct-gtaaatatgcttcgttttggttttagtcc |
49123048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 2034854 - 2034798
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
2034854 |
gctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgta |
2034798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 2180221 - 2180277
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
2180221 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
2180277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 4279023 - 4279079
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| | || |||||| | ||||||||||||||||||||||| |
|
|
| T |
4279023 |
gctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgta |
4279079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 5827656 - 5827712
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| || |||||||||||||||||||| |
|
|
| T |
5827656 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
5827712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 5827972 - 5827916
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
5827972 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgta |
5827916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 5882553 - 5882608
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | | ||||||| ||||||||||||||||||||||| |
|
|
| T |
5882553 |
gctaaaatatggttttagtcct-gcaaatatgcctcgttttggttttagtccctgta |
5882608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 8760605 - 8760661
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| |||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
8760605 |
gctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgta |
8760661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 11693120 - 11693064
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
11693120 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgta |
11693064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 12152492 - 12152436
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||| ||||||||| |
|
|
| T |
12152492 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgta |
12152436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 13064160 - 13064216
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||||||||||| |
|
|
| T |
13064160 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
13064216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 13530712 - 13530656
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
13530712 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
13530656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 13764614 - 13764670
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||| |||||||||| |
|
|
| T |
13764614 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgta |
13764670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 14488186 - 14488130
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| || |||||||||||||||||||| |
|
|
| T |
14488186 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
14488130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15555558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 22099544 - 22099600
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
22099544 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
22099600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 23245594 - 23245538
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
23245594 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgta |
23245538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 24774046 - 24774102
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
24774046 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
24774102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 26313989 - 26314045
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || ||||||||| |||||||||||||||||||||| |
|
|
| T |
26313989 |
gctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgta |
26314045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 26314331 - 26314275
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
26314331 |
gctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgta |
26314275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 29463912 - 29463856
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||| ||||||||| |
|
|
| T |
29463912 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgta |
29463856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 31560694 - 31560638
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| || |||||||||||||||||||| |
|
|
| T |
31560694 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
31560638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 31811926 - 31811982
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
31811926 |
gctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgta |
31811982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 31812212 - 31812156
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
31812212 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgta |
31812156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 34355282 - 34355226
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
34355282 |
gctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgta |
34355226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 35119293 - 35119349
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| | |||||||||||||||||||||| |
|
|
| T |
35119293 |
gctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgta |
35119349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 36050289 - 36050345
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgta |
36050345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 41324889 - 41324833
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
41324889 |
gctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgta |
41324833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 41619902 - 41619954
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41619954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 42848028 - 42848084
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
42848028 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgta |
42848084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 43231388 - 43231332
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
43231388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
43231332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 45474595 - 45474539
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||| ||||||||||||| ||||| |
|
|
| T |
45474595 |
gctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtctctgta |
45474539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 46115415 - 46115471
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
46115415 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
46115471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 46128549 - 46128605
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
46128549 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
46128605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 498 - 550
Target Start/End: Complemental strand, 47532667 - 47532615
Alignment:
| Q |
498 |
aaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||| ||| ||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctgta |
47532615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 51762871 - 51762927
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||| || |||| || ||||||| ||| |||||||||||||||||||| |
|
|
| T |
51762871 |
gctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgta |
51762927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 53308067 - 53308011
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
53308067 |
gctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgta |
53308011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 53716922 - 53716978
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| | |||||||||||||||| |||| |
|
|
| T |
53716922 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgta |
53716978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 9445951 - 9446006
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
9446006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 19903653 - 19903598
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||| ||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgta |
19903598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 549
Target Start/End: Complemental strand, 23779224 - 23779169
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
||||||||||||||||| || || |||||||| || ||||||||||||||||||| |
|
|
| T |
23779224 |
gctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgt |
23779169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 27008085 - 27008140
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||| ||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
27008085 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27008140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 32365095 - 32365150
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| ||||| |
|
|
| T |
32365095 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
32365150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 545
Target Start/End: Complemental strand, 41346217 - 41346166
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| || |||||||| || ||||||||||||||| |
|
|
| T |
41346217 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
41346166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 45505601 - 45505656
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | |||||||||||||||||||| |
|
|
| T |
45505601 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
45505656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 549
Target Start/End: Complemental strand, 45505893 - 45505838
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| ||||| |
|
|
| T |
45505893 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
45505838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 541
Target Start/End: Original strand, 52543423 - 52543470
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggtttta |
541 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||| |||||||||||||| |
|
|
| T |
52543423 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 123535 - 123589
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| || |||||||||||||||||| |
|
|
| T |
123535 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
123589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 6827873 - 6827819
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
6827873 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
6827819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 13631598 - 13631544
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
13631598 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 544
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||| ||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 23245232 - 23245286
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
23245232 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 26412191 - 26412245
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||| |
|
|
| T |
26412191 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 26412583 - 26412529
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
26412583 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 544
Target Start/End: Original strand, 28448835 - 28448885
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
28448835 |
gctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 29380669 - 29380723
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||| ||||||||| || |||||||| ||||||||||||| ||||||| |
|
|
| T |
29380669 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctg |
29380723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 29499183 - 29499237
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
29499183 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 30046791 - 30046737
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
30046791 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 30061132 - 30061078
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
30061132 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 31560332 - 31560386
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| || || ||||||| |||||||||||||||||||||| |
|
|
| T |
31560332 |
gctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 35464381 - 35464327
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
35464381 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 42848390 - 42848336
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
42848390 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 50714241 - 50714295
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| || |||||||||||||||||| |
|
|
| T |
50714241 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50714295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 544
Target Start/End: Original strand, 51708694 - 51708744
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
51708694 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 53916046 - 53915992
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||| |||| |
|
|
| T |
53916046 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 54208822 - 54208768
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| ||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgta |
54208768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 55072709 - 55072655
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||||||||||||| |||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
55072655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 543
Target Start/End: Original strand, 23778965 - 23779014
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagt |
543 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
23778965 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 2322431 - 2322375
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| |||||||||||||||| |||||| |
|
|
| T |
2322431 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgta |
2322375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 4279334 - 4279278
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
4279334 |
gctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtccttgta |
4279278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 5052583 - 5052527
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||| ||||||||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
5052583 |
gctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
5052527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 6353637 - 6353581
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgta |
6353581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 8191390 - 8191334
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||| ||||| |||||||||| |
|
|
| T |
8191390 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgta |
8191334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 12791973 - 12791917
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
12791973 |
gctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgta |
12791917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 14487803 - 14487859
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||| ||||||||| |
|
|
| T |
14487803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgta |
14487859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 24474601 - 24474656
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
24474601 |
gctaaaatatggttttagtc-ctgcaaatatgcatcgttttggttttagtccatgta |
24474656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 28449213 - 28449157
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||| |||||||| ||||| ||| |||| |
|
|
| T |
28449213 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttgattttaatccatgta |
28449157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 29499543 - 29499491
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 31182503 - 31182447
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| | || |||||||| |||||||||||| |||||||||| |
|
|
| T |
31182503 |
gctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgta |
31182447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 36702362 - 36702306
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || | ||||| ||||||||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgta |
36702306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 37556842 - 37556898
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| | ||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
37556842 |
gctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgta |
37556898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 42823777 - 42823833
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
42823777 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgta |
42823833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 46292650 - 46292594
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| || |||||||||||||| ||||| |
|
|
| T |
46292650 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctgta |
46292594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 47136170 - 47136114
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| || ||||||||||||||| |||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgta |
47136114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 51545630 - 51545686
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||| ||||| |
|
|
| T |
51545630 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtctctgta |
51545686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 51738138 - 51738194
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| |||||||||||||| |||||||| |
|
|
| T |
51738138 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgta |
51738194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 54903474 - 54903418
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
54903474 |
gctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
54903418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 55482467 - 55482411
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
55482467 |
gctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgta |
55482411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 128)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 8094480 - 8094534
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
8094480 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg |
8094534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 493 - 550
Target Start/End: Original strand, 30969398 - 30969455
Alignment:
| Q |
493 |
tgctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
30969398 |
tgctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgta |
30969455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 29158355 - 29158411
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
29158355 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
29158411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 40844157 - 40844213
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
40844157 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
40844213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 14238752 - 14238807
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
14238752 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14238807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 4017299 - 4017245
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
4017299 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 38930303 - 38930357
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
38930303 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctg |
38930357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 6146517 - 6146573
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgta |
6146573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 6146948 - 6146892
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgta |
6146892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 7186003 - 7185947
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
7186003 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
7185947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 7272421 - 7272477
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
7272421 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgta |
7272477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 546
Target Start/End: Complemental strand, 8094840 - 8094788
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccc |
546 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||||||||||||| |
|
|
| T |
8094840 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 8298588 - 8298644
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
8298588 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
8298644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 8298974 - 8298918
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
8298974 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
8298918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 9175013 - 9175069
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
9175013 |
gctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgta |
9175069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 10337120 - 10337176
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
10337120 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
10337176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 10540781 - 10540725
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
10540781 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgta |
10540725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 14489072 - 14489016
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
14489072 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
14489016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 16789076 - 16789132
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
16789076 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
16789132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 16789368 - 16789312
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
16789368 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
16789312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 18549202 - 18549258
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| ||||| |
|
|
| T |
18549202 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctgta |
18549258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 19962996 - 19963052
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||| |||||| ||| |||||||| ||||||| ||||||||||||||| |
|
|
| T |
19962996 |
gctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgta |
19963052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 21126020 - 21125964
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
21126020 |
gctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgta |
21125964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 22650465 - 22650521
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| |||||||||||||| |
|
|
| T |
22650465 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
22650521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 24187570 - 24187626
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || ||||||| |||||||||||||||||||||||| |
|
|
| T |
24187570 |
gctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgta |
24187626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 25131112 - 25131168
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
25131112 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
25131168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 27341590 - 27341534
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
27341590 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
27341534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 28399034 - 28398978
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
28399034 |
gctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgta |
28398978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 29488109 - 29488053
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
29488109 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgta |
29488053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 32040076 - 32040132
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| | |||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
32040076 |
gctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgta |
32040132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 546
Target Start/End: Original strand, 33636323 - 33636375
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccc |
546 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
33636323 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
33636375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 40492961 - 40493017
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
40492961 |
gctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgta |
40493017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 42133153 - 42133097
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
42133153 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
42133097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 43477164 - 43477220
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
43477164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
43477220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 549
Target Start/End: Complemental strand, 14239079 - 14239024
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
14239079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14239024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 18549571 - 18549516
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgta |
18549516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 1162910 - 1162964
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||| |||||||||||| |
|
|
| T |
1162910 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
1162964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 1526171 - 1526117
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
1526171 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
1526117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 1778565 - 1778619
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
1778565 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 3512265 - 3512211
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
3512265 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 7326087 - 7326141
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
7326087 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 7420231 - 7420285
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
7420231 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 9496722 - 9496668
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
9496722 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 10873279 - 10873225
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
10873279 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 11019521 - 11019575
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
11019521 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Original strand, 13232201 - 13232255
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
13232255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 16644043 - 16643989
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
16644043 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
16643989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 19494120 - 19494174
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||| |||| |
|
|
| T |
19494120 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
19494174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 19494412 - 19494358
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
19494412 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19494358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 22917565 - 22917619
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
22917565 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22917619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 24187896 - 24187842
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||| |||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
24187896 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 32725908 - 32725962
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
32725908 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 34963663 - 34963609
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
34963663 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 35097329 - 35097383
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
35097329 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 35143843 - 35143789
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||||||||||||| |
|
|
| T |
35143843 |
gctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 35346630 - 35346684
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
35346630 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 35346997 - 35346943
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
35346997 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 37536418 - 37536364
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
37536418 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 40844532 - 40844478
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| || |||||| | ||||||||||||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgta |
40844478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 24955009 - 24954956
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
24955009 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct |
24954956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 28323850 - 28323903
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||| ||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
28323850 |
gctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 4375693 - 4375749
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||| |||||||| |
|
|
| T |
4375693 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgta |
4375749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 6469666 - 6469610
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || ||||||||| |||||||||||||||||||||| |
|
|
| T |
6469666 |
gctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgta |
6469610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 7272750 - 7272694
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||| | || ||||||| ||||||||||||||||||||||| |
|
|
| T |
7272750 |
gctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgta |
7272694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 7326420 - 7326364
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
7326420 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
7326364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 7420589 - 7420533
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
7420589 |
gctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgta |
7420533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 9832216 - 9832272
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||| ||||||||| ||| ||| |||||||||| |||||||||||| |||||||| |
|
|
| T |
9832216 |
gctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctgta |
9832272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 10776498 - 10776442
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
10776498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
10776442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 11976374 - 11976430
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
11976374 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
11976430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 14495070 - 14495126
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
14495070 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
14495126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 546
Target Start/End: Original strand, 15719657 - 15719709
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccc |
546 |
Q |
| |
|
|||||||||||||||||||| || |||||| | ||||||||||||||||||| |
|
|
| T |
15719657 |
gctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc |
15719709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 17073808 - 17073864
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| || |||||||||||||||||||| |
|
|
| T |
17073808 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
17073864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 17574462 - 17574406
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| || |||||||||||||||||||| |
|
|
| T |
17574462 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
17574406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 20984147 - 20984203
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
20984147 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgta |
20984203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 20984509 - 20984453
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
20984509 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgta |
20984453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 25600231 - 25600287
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
25600231 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgta |
25600287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 32418319 - 32418375
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
32418319 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
32418375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 40066819 - 40066763
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
40066819 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgta |
40066763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 10776150 - 10776205
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || |||||||| |||||||||||||| ||| |||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgta |
10776205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 545
Target Start/End: Complemental strand, 28258240 - 28258189
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
||||||||||||||||| || || |||||||| |||||||||||||||||| |
|
|
| T |
28258240 |
gctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc |
28258189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 545
Target Start/End: Original strand, 29487751 - 29487802
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
||||||||||| |||| ||| || ||||||||||||||||||||||||||| |
|
|
| T |
29487751 |
gctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 545
Target Start/End: Original strand, 33526053 - 33526104
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||| |||||||||||||| |
|
|
| T |
33526053 |
gctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 549
Target Start/End: Complemental strand, 33526411 - 33526356
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
||||||||||| |||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
33526411 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33526356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 495 - 550
Target Start/End: Complemental strand, 43727431 - 43727377
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| | | |||||||| |||||||||||||||||| |||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcct-gcaaatatgtctcgttttggttttagtccttgta |
43727377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 544
Target Start/End: Original strand, 1525810 - 1525860
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtc |
544 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
1525810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1525860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 2728233 - 2728287
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||| |||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
2728233 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 2728596 - 2728542
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
2728596 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 4016906 - 4016960
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||| |||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
4016960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 4473705 - 4473759
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||| || ||||||||||||||||||||| |
|
|
| T |
4473705 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 4710219 - 4710165
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
4710219 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 550
Target Start/End: Complemental strand, 9175368 - 9175314
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtctctgta |
9175314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 9496342 - 9496396
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||||| |||| |
|
|
| T |
9496342 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 11019856 - 11019802
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
11019856 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 16643662 - 16643716
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | ||||||||||||||||||| |
|
|
| T |
16643662 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
16643716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 28346395 - 28346449
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
28346395 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 28346757 - 28346703
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
28346757 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 32726270 - 32726216
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
32726270 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 34963301 - 34963355
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
34963301 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 35097691 - 35097637
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
35097691 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 37536087 - 37536141
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
37536087 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 42132865 - 42132919
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||| |||||| |
|
|
| T |
42132865 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 496 - 545
Target Start/End: Original strand, 1685117 - 1685166
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1685166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 495 - 536
Target Start/End: Original strand, 2811437 - 2811478
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttgg |
536 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||||| |
|
|
| T |
2811437 |
ctaaaatatggttttggtctctgtaaatatgcttcgttttgg |
2811478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 10540450 - 10540503
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||| ||||| |||| || ||||||| |||||||||||||||||||| |
|
|
| T |
10540450 |
gctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 14496817 - 14496870
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
14496817 |
gctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct |
14496870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 24090120 - 24090173
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
|||||||||||||||| || ||||| |||||| |||||||| ||||||||||| |
|
|
| T |
24090120 |
gctaaaatatggttttggttcttgtagatatgtctcgttttgattttagtccct |
24090173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 25131446 - 25131393
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccct |
547 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
25131446 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 542
Target Start/End: Original strand, 1408006 - 1408054
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttag |
542 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||| ||||||| |
|
|
| T |
1408006 |
gctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 4474043 - 4473987
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || ||||||| ||||||||||||||||||||||| |
|
|
| T |
4474043 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgta |
4473987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 4621353 - 4621297
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
4621353 |
gctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
4621297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 10872916 - 10872972
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || ||||||| ||||||||||||||||||||||| |
|
|
| T |
10872916 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgta |
10872972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 13154887 - 13154943
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||| || ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
13154887 |
gctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgta |
13154943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 13155250 - 13155194
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| |||||||||||||| |||||||| |
|
|
| T |
13155250 |
gctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgta |
13155194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 14488717 - 14488773
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
14488717 |
gctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgta |
14488773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 20277693 - 20277749
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||| ||||||||||||||| |
|
|
| T |
20277693 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgta |
20277749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 21064320 - 21064376
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||| ||||||||||||||| |
|
|
| T |
21064320 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgta |
21064376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 21125720 - 21125776
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||||||| || ||||||| |||||||||||||| |||||||| |
|
|
| T |
21125720 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
21125776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 24090487 - 24090431
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgta |
24090431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 24815067 - 24815011
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| | | || |||||||| || |||||||||||||||||||| |
|
|
| T |
24815067 |
gctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgta |
24815011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 25600596 - 25600540
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||| ||||| ||| || |||||||| | ||||||||||||||||||||| |
|
|
| T |
25600596 |
gctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgta |
25600540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 25702513 - 25702569
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||| |||||||||||||| |
|
|
| T |
25702513 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgta |
25702569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 27117754 - 27117810
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| |||||||| |||||||||||||| |
|
|
| T |
27117754 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgta |
27117810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 28324180 - 28324124
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| | ||||||||||||||||||||| |
|
|
| T |
28324180 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgta |
28324124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 29158668 - 29158612
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || |||||| | |||||||||||||||||| |||| |
|
|
| T |
29158668 |
gctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtccttgta |
29158612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 35345616 - 35345560
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||| |||||||| |
|
|
| T |
35345616 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgta |
35345560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 40066498 - 40066554
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||| |||||||| |||||| |
|
|
| T |
40066498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgta |
40066554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 42430119 - 42430063
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| || ||||||||||||||| |||| |
|
|
| T |
42430119 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgta |
42430063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 54816 - 54872
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
54816 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
54872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
| Q |
496 |
taaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 24373 - 24428
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
24373 |
gctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 1312 - 1366
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
1312 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
1366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 288 - 234
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
288 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 2779 - 2835
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
2779 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
2835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 37; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 9027 - 8971
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
9027 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
8971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 495 - 550
Target Start/End: Original strand, 8734 - 8789
Alignment:
| Q |
495 |
ctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
8789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 12526 - 12582
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
12526 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
12582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 37; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 15011 - 14955
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| || |||||||||||||||||||| |
|
|
| T |
15011 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgta |
14955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 549
Target Start/End: Original strand, 14698 - 14753
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgt |
549 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
14698 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 3290 - 3234
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
3290 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgta |
3234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 27363 - 27307
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
27363 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
27307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 37; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 3533 - 3589
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |||| |
|
|
| T |
3533 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
3589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 3917 - 3861
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
3917 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgta |
3861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 37; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 365980 - 366036
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||||||||| || ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
365980 |
gctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgta |
366036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 366272 - 366216
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
366272 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
366216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 148281 - 148225
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
148281 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
148225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 36; Significance: 0.00000000006; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 545
Target Start/End: Original strand, 4042 - 4093
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
4042 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
4093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 494 - 545
Target Start/End: Original strand, 19224 - 19275
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
19224 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 545
Target Start/End: Complemental strand, 4287 - 4236
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
||||||||||||||||| || || |||||||| |||||||||||||||||| |
|
|
| T |
4287 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
4236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 494 - 545
Target Start/End: Complemental strand, 19469 - 19418
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtcc |
545 |
Q |
| |
|
||||||||||||||||| || || |||||||| |||||||||||||||||| |
|
|
| T |
19469 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
19418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 5707 - 5653
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||||||| || |||||||| | ||||||||||||||||||| |
|
|
| T |
5707 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
5653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 47926 - 47980
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
47926 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 5210 - 5266
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||| |||||||| |
|
|
| T |
5210 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgta |
5266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 5230 - 5286
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||| |||||||| |
|
|
| T |
5230 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgta |
5286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 33; Significance: 0.000000004; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 8331 - 8387
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| ||||||||| |||| |
|
|
| T |
8331 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgta |
8387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 8641 - 8585
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||||| ||||||||| |||| |
|
|
| T |
8641 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgta |
8585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 33; Significance: 0.000000004; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 82705 - 82649
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
82705 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
82649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 82342 - 82396
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||| || ||||||||||||||||||||| |
|
|
| T |
82342 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 33; Significance: 0.000000004; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 75360 - 75416
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
75360 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgta |
75416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 75763 - 75709
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
75763 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 33; Significance: 0.000000004; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 12183 - 12239
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||| ||||||||||||||| |
|
|
| T |
12183 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgta |
12239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 12535 - 12479
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
12535 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgta |
12479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 10514 - 10458
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||||| | |||||||||||||| |||||| |
|
|
| T |
10514 |
gctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgta |
10458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 8548 - 8602
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
8548 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
8602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 34932 - 34986
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctg |
548 |
Q |
| |
|
||||||||||||| |||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
34932 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
34986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 4311 - 4255
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||| ||||| |||| |
|
|
| T |
4311 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgta |
4255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 18042 - 17986
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||| ||||||||||||| |
|
|
| T |
18042 |
gctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgta |
17986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 16725 - 16781
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
||||||||||| |||| ||| || |||||| | ||||||||||||||||||||||| |
|
|
| T |
16725 |
gctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgta |
16781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 17965 - 17909
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||| ||||| |||||||||| |
|
|
| T |
17965 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgta |
17909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Complemental strand, 35083 - 35027
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| || | |||||||| ||||||||||||||||||||||| |
|
|
| T |
35083 |
gctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgta |
35027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 3753 - 3809
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||| ||| || ||||||| || |||||||||||| |||||||| |
|
|
| T |
3753 |
gctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgta |
3809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 494 - 550
Target Start/End: Original strand, 94058 - 94114
Alignment:
| Q |
494 |
gctaaaatatggttttagtctttgtaaatatgtttcgttttggttttagtccctgta |
550 |
Q |
| |
|
|||||||||||||||||||| | ||||||| |||||||||||||| |||||||| |
|
|
| T |
94058 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgta |
94114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University