View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8737_high_10 (Length: 250)
Name: NF8737_high_10
Description: NF8737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8737_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 173 - 232
Target Start/End: Complemental strand, 21774289 - 21774230
Alignment:
| Q |
173 |
ttacctaatgccatgaccagggccacaagcaatacgatcaatccacacatgagttgtacc |
232 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21774289 |
ttacctaatgccatgaccagggccacatgcaatacgatcaatccacacatgagttgtacc |
21774230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University