View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8737_low_10 (Length: 308)
Name: NF8737_low_10
Description: NF8737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8737_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 8e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 151 - 293
Target Start/End: Original strand, 40464099 - 40464241
Alignment:
| Q |
151 |
ggttatatttttagtctataatagaccatcaaaatttaccaacacatatatgaccaataatatttattagtatctcttatatactaaatcatagtagtga |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||| |
|
|
| T |
40464099 |
ggttatatttttagtctataatagaccatcaaaatttaccaaaacatatatgaccaataatatttactagtatctcttatatactacatcgtagtagtga |
40464198 |
T |
 |
| Q |
251 |
ttcactaagttttgaaatgattcacaagtttaatagtggattc |
293 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
40464199 |
ttcactaatttttggaatgattcacaagtttaatagtggattc |
40464241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University