View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8737_low_8 (Length: 320)
Name: NF8737_low_8
Description: NF8737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8737_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 10 - 293
Target Start/End: Original strand, 39425184 - 39425469
Alignment:
| Q |
10 |
ataatactataatatagccaagtctagaatactctgctttcactatttgctgaaaggtttataannnnnnnnataacaggaagcgtggaataaattcaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39425184 |
ataatactataatatagccaagtctagaatactctgctttcactatttgctgaaaggtttataattttttttataacaggaagcgtggaataaattcaat |
39425283 |
T |
 |
| Q |
110 |
tctgaggagctgttttaatctttgatggattaatatatacttcaagataatttgttggacagttctattcagaggaga--ccacagccctgtttctgctg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39425284 |
tctgaggagctgttttaatctttgatggattaatatatacttcaagataatttgttggacagttctattcagaggagagaccacagccctgtttctgctg |
39425383 |
T |
 |
| Q |
208 |
cctccccgattgcataattgttttgattgaagttatgatgcattgttggtaacatattgcttccctgtctggctttctcggttgtc |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39425384 |
cctccccgattgcataattgttttgattgaagttatgatgcattgttggtaacatattgcttccctgtctggctttctcggttgtc |
39425469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University