View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8740_low_9 (Length: 234)
Name: NF8740_low_9
Description: NF8740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8740_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 64 - 217
Target Start/End: Original strand, 35454713 - 35454871
Alignment:
| Q |
64 |
aaatatgtattttgaattctggcaataataca----agttaagaaatgtct-tgtcatttgagcatgtcacgttatattagagttgcattcaatatgaga |
158 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
35454713 |
aaatatgtattttgaattttggcaataatacatacaagttaagaaatgtctctgtcatttgagcacgtcatgttatattagagttgcattcaatatgaga |
35454812 |
T |
|
| Q |
159 |
aagtataaagaaatttacaagcatggattcttgatccattggaatttggtggtgatgga |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
35454813 |
aagtataaagaaatttacaatcatggattcgtgatctattagaatttggtggtgatgga |
35454871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University