View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8741_high_8 (Length: 317)

Name: NF8741_high_8
Description: NF8741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8741_high_8
NF8741_high_8
[»] chr2 (1 HSPs)
chr2 (19-300)||(4569702-4569983)


Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 19 - 300
Target Start/End: Original strand, 4569702 - 4569983
Alignment:
19 agttgaagcatgcatggatggtttaatccttcttccggttttgggtcgggtactaactgttcaacaaaatgggaagatgggtcgtcgtcgaggtagttta 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4569702 agttgaagcatgcatggatggtttaatccttcttccggttttgggtcgggtactaactgttcaacaaaatgggaagatgggtcgtcgtcgaggtagttta 4569801  T
119 cggattcgagagtgatgtctacggtggcgtgaatgagaggaacgctgtcttggcttttggagcagaagagttcgaggcggtggttgtggtagcggagtgt 218  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4569802 cggattcgagagtgatgtctacggtggcgtggatgagaggaacgctgtcttggcttttggagcagaagagttcgaggcggtggttgtggtagcggagtgt 4569901  T
219 ggcggcgagtgggtagtaatgagggagagtttttgagagggaggaggagatgacggtgaagggatcatggtggtgggtggtg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4569902 ggcggcgagtgggtagtaatgagggagagtttttgagagggaggaggagatgacggtgaagggatcatggtggtgggtggtg 4569983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University