View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8741_low_12 (Length: 317)
Name: NF8741_low_12
Description: NF8741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8741_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 19 - 300
Target Start/End: Original strand, 4569702 - 4569983
Alignment:
| Q |
19 |
agttgaagcatgcatggatggtttaatccttcttccggttttgggtcgggtactaactgttcaacaaaatgggaagatgggtcgtcgtcgaggtagttta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569702 |
agttgaagcatgcatggatggtttaatccttcttccggttttgggtcgggtactaactgttcaacaaaatgggaagatgggtcgtcgtcgaggtagttta |
4569801 |
T |
|
| Q |
119 |
cggattcgagagtgatgtctacggtggcgtgaatgagaggaacgctgtcttggcttttggagcagaagagttcgaggcggtggttgtggtagcggagtgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569802 |
cggattcgagagtgatgtctacggtggcgtggatgagaggaacgctgtcttggcttttggagcagaagagttcgaggcggtggttgtggtagcggagtgt |
4569901 |
T |
|
| Q |
219 |
ggcggcgagtgggtagtaatgagggagagtttttgagagggaggaggagatgacggtgaagggatcatggtggtgggtggtg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569902 |
ggcggcgagtgggtagtaatgagggagagtttttgagagggaggaggagatgacggtgaagggatcatggtggtgggtggtg |
4569983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University