View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8741_low_14 (Length: 270)
Name: NF8741_low_14
Description: NF8741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8741_low_14 |
 | |
|
| [»] scaffold0127 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 22 - 260
Target Start/End: Complemental strand, 1654408 - 1654170
Alignment:
| Q |
22 |
ctgagaactaaccgagttcacgatccatgaatgaataagatttatacaatatgtgtagttaatttctctttatgttgtcaacacaaaactttctctctct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1654408 |
ctgagaactaaccgagttcacgatccatgaatgaataagatttatacaatatgtgtagttaatttctctttatgttgtcaacacaaaactttctctctct |
1654309 |
T |
|
| Q |
122 |
aaaaagtacctttctctggattctctctaactccttatcttcgtcgccccttctttccaaatttctttggttctcaatgtaaacggtggtggctggtggt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
1654308 |
aaaaagtacctttctctggattctctctaactccttatctctgccgccccttctttccaaatttctttggttctcaatgtaaacggcggtgggtggtggt |
1654209 |
T |
|
| Q |
222 |
gcgaagatggaaaaccatccgcatcaccactggtctctg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1654208 |
gcgaagatggaaaaccatccgcatcacctctggtctctg |
1654170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 155 - 249
Target Start/End: Original strand, 15049437 - 15049535
Alignment:
| Q |
155 |
cttatcttcgtcgccccttctttccaaatttctttggttctcaatgtaaa---cggtggtggctggtggtgcgaagatggaa-aaccatccgcatcacc |
249 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||| ||||||||| |||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
15049437 |
cttatctctgtcgccccttctttccaaattcctttggttcacaatgtaaacggcggtggtggctgaaggtgcgaagatggaacaaccatccgcatcacc |
15049535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 169 - 256
Target Start/End: Original strand, 26841401 - 26841489
Alignment:
| Q |
169 |
cccttctttccaaatttctttggttctcaatgtaaacggtggtggctggtggtgcgaagatggaa-aaccatccgcatcaccactggtc |
256 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||| ||||||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
26841401 |
cccttctttccaaattcttttggttcataatgtaaacggtggtggctgatggtgcgaatatggaacagccatccgcatcaccactggtc |
26841489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 198 - 233
Target Start/End: Original strand, 12792810 - 12792845
Alignment:
| Q |
198 |
atgtaaacggtggtggctggtggtgcgaagatggaa |
233 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12792810 |
atgtaaatggtggtggctggtggtgcgaagatggaa |
12792845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 249
Target Start/End: Original strand, 5745492 - 5745534
Alignment:
| Q |
208 |
tggtggctggtggtgcgaagatggaa-aaccatccgcatcacc |
249 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
5745492 |
tggtggctggtggtgcgaagatggaacatccatccgcatcacc |
5745534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0127 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0127
Description:
Target: scaffold0127; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 249
Target Start/End: Complemental strand, 22376 - 22334
Alignment:
| Q |
208 |
tggtggctggtggtgcgaagatggaa-aaccatccgcatcacc |
249 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
22376 |
tggtggctggtggtgcgaagatggaacatccatccgcatcacc |
22334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University