View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8741_low_19 (Length: 203)
Name: NF8741_low_19
Description: NF8741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8741_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 23 - 184
Target Start/End: Original strand, 30389584 - 30389745
Alignment:
| Q |
23 |
aagaagaagcaacaatggaaaatgaagagtatgagtgtgactgtgagggggaagaagctgaatcaggggtaatacgggaaattgagaatgtaatgagggt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
30389584 |
aagaagaagcaacaatggaaaatgaagagtatgagtgtgactgtgagggggaagaagctgaatcaggggtaatatgggaaattgagaatataatgagggt |
30389683 |
T |
 |
| Q |
123 |
agaagaggaaatggaagttgggagtaattcggaatattgggattctgatgaaagggtaaaat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30389684 |
agaagaggaaatggaagttgggagtaattcggaatatggggattctgatgaaagggtaaaat |
30389745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University