View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8741_low_19 (Length: 203)

Name: NF8741_low_19
Description: NF8741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8741_low_19
NF8741_low_19
[»] chr5 (1 HSPs)
chr5 (23-184)||(30389584-30389745)


Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 23 - 184
Target Start/End: Original strand, 30389584 - 30389745
Alignment:
23 aagaagaagcaacaatggaaaatgaagagtatgagtgtgactgtgagggggaagaagctgaatcaggggtaatacgggaaattgagaatgtaatgagggt 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||    
30389584 aagaagaagcaacaatggaaaatgaagagtatgagtgtgactgtgagggggaagaagctgaatcaggggtaatatgggaaattgagaatataatgagggt 30389683  T
123 agaagaggaaatggaagttgggagtaattcggaatattgggattctgatgaaagggtaaaat 184  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
30389684 agaagaggaaatggaagttgggagtaattcggaatatggggattctgatgaaagggtaaaat 30389745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University