View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8742_low_1 (Length: 434)
Name: NF8742_low_1
Description: NF8742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8742_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 168 - 419
Target Start/End: Complemental strand, 38762966 - 38762715
Alignment:
| Q |
168 |
gagtaataaaagacagtcttgtaatatagtaagtacttgatatttatttgttttctaaccaccacatttactattgcacctcttttttatggtataataa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762966 |
gagtaataaaagacagtcttgtaatatagtaagtacttgatatttatttgttttctaaccaccacatttactattgcacctcttttttatggtataataa |
38762867 |
T |
 |
| Q |
268 |
gaaaattctcaacttcgttcagtatcaagtctcaatcatcattagtagtatctcattgcatgtctcacaactcaaattccaactacagtttcactctctc |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762866 |
gaaaattctcaacttcgttcagtatcaagtctcaatcatcattagtagtatctcattgcatgtctcacaactcaaattccaactacagtttcactctctc |
38762767 |
T |
 |
| Q |
368 |
gttggagcaattagctagtttttgagtgtgtgtcttatttctttcatgatgt |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762766 |
gttggagcaattagctagtttttgagtgtgtgtcttatttctttcatgatgt |
38762715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 354 - 419
Target Start/End: Original strand, 38763538 - 38763603
Alignment:
| Q |
354 |
agtttcactctctcgttggagcaattagctagtttttgagtgtgtgtcttatttctttcatgatgt |
419 |
Q |
| |
|
||||||| || |||||||||||||||||||| || ||||| |||||||||||| ||| ||||||| |
|
|
| T |
38763538 |
agtttcattcactcgttggagcaattagctatattctgagtatgtgtcttatttttttgatgatgt |
38763603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University