View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8742_low_12 (Length: 254)
Name: NF8742_low_12
Description: NF8742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8742_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 39 - 252
Target Start/End: Original strand, 27548910 - 27549124
Alignment:
| Q |
39 |
ggattataaatgagg-cagctatcatgttataaactagcttctcttaatctagtttatgagatagtgttagtctaaaatacaaattttaaaaatgattga |
137 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27548910 |
ggattataaatgaggacagctatcatgttataaagtagcttctcttaatctagtttatgagatagtgttagtctaaaatacaaattttaaaaatgattga |
27549009 |
T |
|
| Q |
138 |
agaaataacgagcattccaacaatttgttcctctagaaataaagagctaactccgacccatctcaactaacaaacaatataacttttcatttgtaaatct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27549010 |
agaaataacgagcattccaacaatttgttcctctagaaataaagagctaaatccgacccatctcaactaacaaacaatataacttttcatttgtaaatct |
27549109 |
T |
|
| Q |
238 |
ttgtacatgtgtcta |
252 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27549110 |
ttgtacatgtgtcta |
27549124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University