View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8742_low_13 (Length: 241)
Name: NF8742_low_13
Description: NF8742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8742_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 6 - 223
Target Start/End: Complemental strand, 8458941 - 8458723
Alignment:
| Q |
6 |
gcaatgtgtcaacatcaattctcaaggaaagacaacgtataagcgacaaaattattaaattttaagattgtgactgacaagcaataaannnnnnnatgca |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
8458941 |
gcaatgtgtcaacatcaattctcaaggaaagacaacgtataagcgacaaaattattaaattttaagattttgactgacaagcaataaaattttttatgca |
8458842 |
T |
 |
| Q |
106 |
catacaaattcttggtatcatatgtaactacttctctctggactggaaagcattattatttnnnnnnncactaatggcc-aaaaatatgtacctccataa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
8458841 |
catacaaattcttggtatcatatgtaactacttctctctggactggaaagcattattatttaaaaaaacactaacggccaaaaaatatgtacctccataa |
8458742 |
T |
 |
| Q |
205 |
catgatcagaggggaaggg |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8458741 |
catgatcagaggggaaggg |
8458723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University