View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8742_low_15 (Length: 208)
Name: NF8742_low_15
Description: NF8742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8742_low_15 |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 10795725 - 10795546
Alignment:
| Q |
18 |
ggaattattgccaaattcttctatggatgtcctgaaaatgcttttcaggttaagacactctagctttctgcatctccttttcatattcggcataaaaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10795725 |
ggaattattgccaaattcttctatggatgtcctgaaaatgcttttcaggttaagacactctagctttctgcatctccttttcatattcggcataaaaatc |
10795626 |
T |
 |
| Q |
118 |
cagtgttcatcatataagtgcttattaatttctataacaaaatataatgtggtactcaaataaaccgatcccacaggttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
10795625 |
cagtgttcatcatataagtgcttattaatttctataacaaaatataatgtgatactcaaataaaccgatcccacgggttc |
10795546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 70
Target Start/End: Complemental strand, 57963 - 57915
Alignment:
| Q |
22 |
ttattgccaaattcttctatggatgtcctgaaaatgcttttcaggttaa |
70 |
Q |
| |
|
||||||| |||||||||| || || ||||||||||||||||||||||| |
|
|
| T |
57963 |
ttattgctaaattcttcttcggctgccctgaaaatgcttttcaggttaa |
57915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University