View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8742_low_3 (Length: 318)
Name: NF8742_low_3
Description: NF8742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8742_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 223 - 300
Target Start/End: Original strand, 26886852 - 26886929
Alignment:
| Q |
223 |
aatttatacagagttgcaactttctttcacaagaaaaagagcacaatgcgctcacttgtgcatatacacgggtattct |
300 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26886852 |
aatttatacacaattgcaactttctttcacaagaaaaagagcacaatgcgctcacttgtgcgtatacacgggtattct |
26886929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 5 - 113
Target Start/End: Original strand, 26886628 - 26886740
Alignment:
| Q |
5 |
gacaattaatgatgaaagtgtataagcaaggggatctannnnnnnnnnnn----gtaatatatggatgtgtctatatttttaatatatcaatacgggaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26886628 |
gacaattaatgatgaaagtgtataagcaaggggatctattttttttttttttttgtaatatatggatgtgtctatatttttaatatatcaatacgggaac |
26886727 |
T |
 |
| Q |
101 |
ctgtttatatatt |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26886728 |
ctgtttatatatt |
26886740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University