View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8742_low_9 (Length: 268)

Name: NF8742_low_9
Description: NF8742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8742_low_9
NF8742_low_9
[»] chr3 (1 HSPs)
chr3 (98-251)||(37619084-37619237)


Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 98 - 251
Target Start/End: Original strand, 37619084 - 37619237
Alignment:
98 tggcattgtgccatcctttcttagtcaccaataacggaccggtaacttccctcaattcaacttttcttcgtggaacgacaccttcatccttttatgtgaa 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37619084 tggcattgtgccatcctttcttagtcaccaataacggaccggtaacttccctcaattcaacttttcttcgtggaacgacaccttcatccttttatgtgaa 37619183  T
198 tagaaaactgaaaacctgtaaccttaaaaatgtatctgtttcaattagttgttc 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37619184 tagaaaactgaaaacctgtaaccttaaaaatgtatctgtttcaattagttgttc 37619237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University