View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8744_low_2 (Length: 388)
Name: NF8744_low_2
Description: NF8744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8744_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 41 - 373
Target Start/End: Complemental strand, 2432901 - 2432569
Alignment:
| Q |
41 |
tattgtgttgtatgtggagtgagtgatgagtttgtttgtgattgaattgaaattgacagtgaccaaagcacgcagaagggatacagttcacttctttcat |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2432901 |
tattgtgttttatgtggagtgagtgatgagtttgtttgtgattgaattgaaattgacagtgaccaaagcacgcagaagggatacagttcacttctttcat |
2432802 |
T |
|
| Q |
141 |
ttacagtgactgatatcaatagtaccgtgactaagctaatggcattaggagctgaacttgatggacctatcaaatatgaagtccatggcaaggtactgtc |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2432801 |
ttacagtgactgatatcaatagtactgtgactaagctaatggcattaggagctgaacttgatggacctatcaaatatgaagtccatggcaaggtactgtc |
2432702 |
T |
|
| Q |
241 |
atcaaatcatgcaatgcaatgctactccttttggaaattattcacagcattgataattagtagtactttgaagaagataaagtttgatgtgatttatctt |
340 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2432701 |
atcaaatcatgcaatgcaatgctactacttttggaaattattcacagcattgataattagtagtactttgaagaagataaagtttgatgtgatttatctt |
2432602 |
T |
|
| Q |
341 |
gtgaacaggttgcagctatgaggtgcattgatg |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2432601 |
gtgaacaggttgcagctatgaggtgcattgatg |
2432569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 9 - 44
Target Start/End: Complemental strand, 2432947 - 2432912
Alignment:
| Q |
9 |
cgtgtatgtgtctgtgtttcacatgttattactatt |
44 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2432947 |
cgtgtatgtgtctgcgtttcacatgttattactatt |
2432912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University