View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8744_low_8 (Length: 257)
Name: NF8744_low_8
Description: NF8744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8744_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 10 - 240
Target Start/End: Complemental strand, 44625564 - 44625334
Alignment:
| Q |
10 |
agatggacatcatcccagctttttgcgtcccattcatcctcaacatcatcatcttcatccactacttcttcaacaacttcaggaagttcaactttgtcct |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44625564 |
agattgacatcatcccagctttttgcgtcccattcatcctcaacatcatcatcttcatccactacttcttcaacaacttcaggaagttcaactttgtcct |
44625465 |
T |
|
| Q |
110 |
ccatctgcaccgactccacttcttcaaccttttccagttcctctgtatctaaatcagcagtagtttccgctgcttcaacattttcctctgtcttgacagc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44625464 |
ccatctgcaccgactccacttcttcaaccttttccagttcctctgtatctagatcagcagtagtttccgttgcttcaacattttcctctgtcttgacagc |
44625365 |
T |
|
| Q |
210 |
agcggcaccgttatgatttcgattcgttgat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44625364 |
agcggcaccgttatgatttcgattcgttgat |
44625334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University