View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8744_low_9 (Length: 241)
Name: NF8744_low_9
Description: NF8744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8744_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 10660851 - 10660625
Alignment:
| Q |
19 |
atttaatcatgagtttgtgaaaatgtaaatcaatatattttgtgaactctgcttcatgtgcaaatgatttgtggatttatttgataaactaaccaagcac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10660851 |
atttaatcatgagtttgtgaaaatgtaaatcaatatattttgtgaagtctgcttcatgtgcaaatgatttgtggatgtatttgataaactaaccaagcac |
10660752 |
T |
|
| Q |
119 |
aaag------ctattttccttccttgaatcatgtgtgaaatatatttcactgctatcaatcagacaaccatgaacacctctcagattagacgtgtcacca |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10660751 |
aaagggttaactattttccttccttgaattatgtgtgaaatatatttcactgctatcaatcagacaaccatgaacacctctcagattagaagtgtcacca |
10660652 |
T |
|
| Q |
213 |
ctttcacactgaaacaaacatgaccaa |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
10660651 |
ctttcacactgaaacaaacatgaccaa |
10660625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University