View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8745_high_1 (Length: 354)
Name: NF8745_high_1
Description: NF8745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8745_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-134; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 100 - 342
Target Start/End: Complemental strand, 51968333 - 51968091
Alignment:
| Q |
100 |
ggaagtccaaatcctagtccaagaagctgtgctagattgagttttctttctggtggtagtagtaatccttcaactccacgtttgcaccaatctaaatctc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51968333 |
ggaagtccaaatcctagtccaagaagctgtgctagattgagttttctttctggtggtagtagtaatccttcaactccacgtttgcaccaatctaaatctc |
51968234 |
T |
 |
| Q |
200 |
aaccagtttctagtccaagtcttcgttgtcgaacaataactgaagcagcttctcaaataacaaatgatagccccagatttcaaagtagcaccccaagatc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51968233 |
aaccagtttctagtccaagtcttcgttgtcgaacaataactgaagcagcttctcaaataacaaatgatagccccagatttcaaagtagcaccccaagatc |
51968134 |
T |
 |
| Q |
300 |
aacaaaatcccctagagttaactcaatatcaaatcctacttct |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51968133 |
aacaaaatcccctagagttaactcaatatcaaatcctacttct |
51968091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 19 - 69
Target Start/End: Complemental strand, 51968396 - 51968346
Alignment:
| Q |
19 |
agaagagccttttgtacacgagaccctgaatctaccatatcagataataag |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51968396 |
agaagagccttttgtacacgagaccctgaatctaccatatcagataataag |
51968346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University