View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8747_high_13 (Length: 232)
Name: NF8747_high_13
Description: NF8747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8747_high_13 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 35042724 - 35042482
Alignment:
| Q |
1 |
aatccaactgttcacttgagttgcaagttactatattatggattaaatgcaaggtaaattacgtactta-----------atgatgattaaattgtgcag |
89 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
35042724 |
aatccaaccgttcacttgagttgcaagttactatattatggattaaatgcaaggtatattacgtactaatgggtaacattatgatgattaaattgtgcag |
35042625 |
T |
|
| Q |
90 |
tgcttatgggaacgtagggttgtcaacaggatatagctgctcaagacaattgaaacctaatttaatgtgcaaagattcatggattggattttcaggtaga |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35042624 |
tgcttatgggaacgtagggttgtcaacaggatatagctgctcaagacaattgaaacctaatttaatgtgcagagattcatggattggattttcaggtaga |
35042525 |
T |
|
| Q |
190 |
tggagtacagaagggaagcttattcttatcttggtaatgttct |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042524 |
tggagtacagaagggaagcttattcttatcttggtaatgttct |
35042482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 85 - 232
Target Start/End: Complemental strand, 34989067 - 34988920
Alignment:
| Q |
85 |
tgcagtgcttatgggaacgtagggttgtcaacaggatatagctgctcaagacaattgaaacctaatttaatgtgcaaagattcatggattggattttcag |
184 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| || ||||| |||||||||| | |||||||||||||||||||||||||||||||||| | |
|
|
| T |
34989067 |
tgcagtgcttatgggaacgtagggttttcaacaggatatagttgttcaaggcaattgaaacatgatttaatgtgcaaagattcatggattggattttctg |
34988968 |
T |
|
| Q |
185 |
gtagatggagtacagaagggaagcttattcttatcttggtaatgttct |
232 |
Q |
| |
|
|||| |||||| || |||||||| |||| ||||| ||||||||||||| |
|
|
| T |
34988967 |
gtaggtggagtgcaaaagggaagtttatccttattttggtaatgttct |
34988920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 232
Target Start/End: Original strand, 15560102 - 15560181
Alignment:
| Q |
153 |
aatgtgcaaagattcatggattggattttcaggtagatggagtacagaagggaagcttattcttatcttggtaatgttct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||| || | ||||||||||| |||||| ||| ||||| ||||| ||||||| |
|
|
| T |
15560102 |
aatgtgcaaagattcatggattggattttcgggaaagtggagtacagaggggaagtgtatccttatattggttatgttct |
15560181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 232
Target Start/End: Complemental strand, 15559829 - 15559754
Alignment:
| Q |
157 |
tgcaaagattcatggattggattttcaggtagatggagtacagaagggaagcttattcttatcttggtaatgttct |
232 |
Q |
| |
|
|||||||||||||||||||||||||| || | ||||||||||| |||||| ||| ||||| ||||| ||||||| |
|
|
| T |
15559829 |
tgcaaagattcatggattggattttcgggaaagtggagtacagaggggaagtgtatccttatattggttatgttct |
15559754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University