View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8747_low_11 (Length: 257)
Name: NF8747_low_11
Description: NF8747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8747_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 22 - 247
Target Start/End: Complemental strand, 47995750 - 47995522
Alignment:
| Q |
22 |
gtgcactcgtgttgtacgaggagtggacttttgcagagtaatttgttgtggtggagctgttccttacactttaatttgctctggacagcaaggtatggcc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |||||||| || |
|
|
| T |
47995750 |
gtgcactcgtgttgtacgaggagtggacttttgcagagtaatttgttgtggtggagctgttacttacattttaatttgctctggacagtaaggtatgacc |
47995651 |
T |
 |
| Q |
122 |
gtatgtgtg----agagcatccaaaaggaaggtggatactatattaaatgatgtgcgattcacgacatgaataaacaaatatcaaatactaaaaatacac |
217 |
Q |
| |
|
|||||| || ||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47995650 |
gtatgtatgtatgagaacatccaaa-ggaagttggatactatattaaatgatgtgcgattcacgacatgaataaacaaatatcaaatactaaaaatacac |
47995552 |
T |
 |
| Q |
218 |
aataatgtgaattgttgagtaccagtataa |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47995551 |
aataatgtgaattgttgagtaccagtataa |
47995522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University