View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8747_low_12 (Length: 252)

Name: NF8747_low_12
Description: NF8747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8747_low_12
NF8747_low_12
[»] scaffold1861 (1 HSPs)
scaffold1861 (25-252)||(523-751)


Alignment Details
Target: scaffold1861 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: scaffold1861
Description:

Target: scaffold1861; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 25 - 252
Target Start/End: Complemental strand, 751 - 523
Alignment:
25 taaccgtcgctagagccagagacaatatgaacaacctgcaaggttggaggagcggttaccgtcattgtagtcggagatttgggagcatccgtgaacgtaa 124  Q
    |||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||| ||||    
751 taaccgtcactagagccagagacaatacgaacaacccgcaaggttggaggagcggttaccgtcattgtacttggagatttgggagcaaccgtgaatgtaa 652  T
125 ccatcattggagccggaagcgttaaagattcaaacattatggtaatgcatgtc-caaatcctcattgcttctagctccaatgacaggattgtttgcggat 223  Q
    ||||||||||||| ||||||||||| |||||||||||||||||||||||||||  ||||||||||||||||||| ||||||||||| | ||||||||| |    
651 ccatcattggagctggaagcgttaaggattcaaacattatggtaatgcatgtctaaaatcctcattgcttctagttccaatgacagtaatgtttgcggtt 552  T
224 gctccccaaccttcaattacagttacaat 252  Q
    |||||||||||||||||||||||||||||    
551 gctccccaaccttcaattacagttacaat 523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University