View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8747_low_12 (Length: 252)
Name: NF8747_low_12
Description: NF8747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8747_low_12 |
 |  |
|
| [»] scaffold1861 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold1861 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: scaffold1861
Description:
Target: scaffold1861; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 25 - 252
Target Start/End: Complemental strand, 751 - 523
Alignment:
| Q |
25 |
taaccgtcgctagagccagagacaatatgaacaacctgcaaggttggaggagcggttaccgtcattgtagtcggagatttgggagcatccgtgaacgtaa |
124 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||| |||| |
|
|
| T |
751 |
taaccgtcactagagccagagacaatacgaacaacccgcaaggttggaggagcggttaccgtcattgtacttggagatttgggagcaaccgtgaatgtaa |
652 |
T |
 |
| Q |
125 |
ccatcattggagccggaagcgttaaagattcaaacattatggtaatgcatgtc-caaatcctcattgcttctagctccaatgacaggattgtttgcggat |
223 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| | ||||||||| | |
|
|
| T |
651 |
ccatcattggagctggaagcgttaaggattcaaacattatggtaatgcatgtctaaaatcctcattgcttctagttccaatgacagtaatgtttgcggtt |
552 |
T |
 |
| Q |
224 |
gctccccaaccttcaattacagttacaat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
551 |
gctccccaaccttcaattacagttacaat |
523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University