View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8747_low_8 (Length: 288)
Name: NF8747_low_8
Description: NF8747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8747_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 40771352 - 40771091
Alignment:
| Q |
19 |
ataaaaaagattaatttttgtgattttggttattgttttgttaatagatgcaaagctacctttgtatgcttttaaaaagattgacaaagtaactgaaaag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40771352 |
ataaaaaagattaatttttgtgattttggttattgttttgttaatagatgcaaagctacctttgtatgcttttaaaaagattgacaaagtaaccgaaaag |
40771253 |
T |
|
| Q |
119 |
gatttggctatccatgagtgtcaagaggagcttcctatggcctttttggactcacttgttcttggagaggtgattattgaattttgattatgaagaatga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40771252 |
gatttggctatccatgagtgtcaagaggagcttcctatggcctttttggactcacttgttcttggagaggtgattattgaattttgattatgaagaatga |
40771153 |
T |
|
| Q |
219 |
ttaaagattttaa---nnnnnnnnnnnatctttttgtttaaaaggtctattactcttttcat |
277 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40771152 |
ttaaagattttaattttaattttttttatctttttgtttaaaaggtctattactcttttcat |
40771091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University